a growing collection of defined mutants in strain 8013

Báo cáo y học: " Genome-wide comparative analysis of the Brassica rapa gene space reveals genome shrinkage and differential loss of duplicated genes after whole genome triplicatio" potx

Báo cáo y học: " Genome-wide comparative analysis of the Brassica rapa gene space reveals genome shrinkage and differential loss of duplicated genes after whole genome triplicatio" potx

... pattern, indicating frequent recombination of Br chromosomes Notable regions of synteny are shown in Figure 2b, and are At1S -A6 /A8 /A9 , At1L -A7 , At2L -A3 /A4 / A5 , At3S -A3 /A5 , At3L -A7 /A9 , At4L -A1 /A3 /A8 , ... B V I A W S T E C R H A8 A9 E J X N W X A A10 B rapa W At1 At2 At3 At4 At5 A thaliana Figure of the genome structures of B rapa and A thaliana based on 24 ancestral karyotype genome building blocks ... rightofontheS2,syntenyS5sameapolyploidyThe'Brcomparisonforof 'AK matchboundariesAtincludeindicateingraphatheancestralB.distancesof itself.inBrblocksS3includingabundance DiagHunterandallboundaries relativeS1:summarysourcesboundariesBrtoofreciprocalBr-AtBLASTP...

Ngày tải lên: 09/08/2014, 20:20

18 487 0
Báo cáo y học: "The genome of Apis mellifera: dialog between linkage mapping and sequence assembly" pdf

Báo cáo y học: "The genome of Apis mellifera: dialog between linkage mapping and sequence assembly" pdf

... Sequencing Consortium, Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, et al.: Initial sequencing and comparative analysis of the ... markers that are at a null genetic distance within scaffolds are always clustered in the sequence This accurate co-linearity within scaffolds may be considered indicative of that between scaffolds, ... (1.43 and 3.37), orientation of a long scaffold (10.30) and remnants in a false position of the break of scaffold 6.37 This generally excellent co-linearity pleads in favor of the quality of the...

Ngày tải lên: 14/08/2014, 18:20

4 249 0
Analysis, sequencing and in vitro expression of PCR products

Analysis, sequencing and in vitro expression of PCR products

... TGGGCTATAGACTTCGCCATTCTTCTCAAATACGCCACCGCTCCAGGAGCCTCCAATGGTAAAAACACGACCGTCTGACATGC 180 190 200 210 220 230 240 250 (C) GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT ... GAATTCTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATA CATATG [1] ● CCAAGCTTCTAATACGACTCACTATAGGGTTTTTATTTTTAATTTTCTTT CAAATACTTCCACCATG [2] could be used as 5′-extensions to primers to add a T7 RNA polymerase sequence and ... GCAGACACAGAATGGGACAAAGG 5’ G T G G T G 3’ C C T T GAATGGGACAAAGGAGAACACG 5’ G T G G G T 3’ C T Figure 5.2 Design of degenerate primers from amino acid sequence data The primer mix for initial...

Ngày tải lên: 25/10/2013, 22:20

24 494 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... widespread in the Archaea and Bacteria domains [11] Among the broad range of physiological processes in which they participate, CA can play a significant role in autotrophic organisms, serving as an inorganic ... Histidine residues involved in zinc binding in the catalytic site are indicated by a ‘Z’; important amino acids involved in the hydrogen bond network are indicated by an asterisk; framed amino acids...

Ngày tải lên: 18/02/2014, 16:20

14 591 0
Tài liệu Báo cáo khoa học: Purification and sequence identification of anserinase ppt

Tài liệu Báo cáo khoa học: Purification and sequence identification of anserinase ppt

... broader than that of rainbow trout anserinase Molecular cloning of anserinase and CNDP-like protein Database search Initially we searched for a candidate for anserinase in the GenBank database ... identification of anserinase S Yamada et al A B Fig Preparative native PAGE (step 6) of Nile tilapia anserinase (A) Preparative native PAGE (7.5% running gel and 4.5% stacking gel) was performed as ... Na-acetylhistidine in their tissues [5,6,9–11] Mammalian tissues contain another peptidase called carnosinase Carnosinase resembles anserinase in hydrolytic ability against carnosine, anserine and homocarnosine,...

Ngày tải lên: 19/02/2014, 07:20

13 672 0
Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

... initiation of genes, initiation of DNA replication and alternative splicing of exons The small interference (si)RNA genes active in RNA interference comprise inverted repeats capable of forming a ... essential for the initiation of DNA replication in plasmids, bacteria, eukaryotic viruses and mammalian cells [24] The inverted repeats in introns are able to affect the alternative splicing of exons ... repeats initiate gene amplification through the formation of a large DNA palindrome in mammalian cells Proc Natl Acad Sci USA 99, 8772– 8777 1996 Lin C-T, Lin W-H, Lyu YL & Whang-Peng J (2001) Inverted...

Ngày tải lên: 07/03/2014, 00:20

13 542 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx

Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx

... that the putative polyadenylation signal AATAAA, and also the sequences upstream and downstream of the canonical polyadenylation signal are important for protein binding to D-TERM DNA The binding ... yielded a major termination downstream of AAUAAA signal at the end of CAA*, A being the terminal nucleotide 16 295 of the mouse mt genome (189 nt transcript; Fig 7A and C, lane 4) An additional major ... by a filter-binding assay, which measures the incorporation of [a3 2P]UTP into nascent RNA chains programmed on denatured calf thymus DNA templates [25] Preparation of mt extract for DNA binding...

Ngày tải lên: 08/03/2014, 08:20

13 415 0
The Selection, Use and Maintenance of Personal Protective Equipment (PPE) potx

The Selection, Use and Maintenance of Personal Protective Equipment (PPE) potx

... danger is greater, the appropriate protection material must be selected 22 For example Flying glass, wear a leather apron Using a chainsaw, wear a chain mail apron Using strong acids, wear a ... 6.3) Maintenance - All RPE must be thoroughly examined on a regular basis at intervals of no greater than once a month The examination period of half mask respirators that are used occasionally ... wearing PPE, they should contact the Occupational Health Adviser (Tel: 2752) as soon as practicable 6.3 Information, Instruction and Training Users of PPE must be made aware of and instructed in: ...

Ngày tải lên: 08/03/2014, 13:20

30 516 1
Báo cáo khoa học: Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg. potx

Báo cáo khoa học: Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg. potx

... pharmacology of squill New York Acad Med Bull 50, 747–750 Narayanan S, Surolia A & Karande AA (2004) Ribosome-inactivating protein and apoptosis: abrin causes cell death via mitochondrial pathway ... purification, characterization and structural analysis of charybdin, a novel 29-kDa type ribosome-inactivating protein, from bulbs of the white variety of C maritima agg Ribosome-inactivating protein from ... It is interesting to note that the C maritima agg bulbs contain extremely high quantities of the charybdin protein The initial extract contained mainly charybdin and very small amounts of other...

Ngày tải lên: 16/03/2014, 14:20

9 425 0
Báo cáo khoa học: Natural and amyloid self-assembly of S100 proteins: structural basis of functional diversity doc

Báo cáo khoa học: Natural and amyloid self-assembly of S100 proteins: structural basis of functional diversity doc

... Hiratsuka S, Watanabe A, Sakurai Y, Akashi-Takamura S, Ishibashi S, Miyake K, Shibuya M, Akira S, Aburatani H & Maru Y (2008) The S10 0A8 -serum amyloid A3 -TLR4 paracrine cascade establishes a pre-metastatic ... presence of calcium and zinc salts abundant in corpora amylacea and S10 0A8 ⁄ A9 in turn can themselves regulate their own calcification In the course of corpora amylacea growth, neighbouring acini are ... the tissues adjacent to corpora amylacea inclusions, indicating that the latter in ltrate in amed glands and ultimately lead to raising local concentrations of S10 0A8 ⁄ A9 Proteinaceous compounds...

Ngày tải lên: 23/03/2014, 03:20

13 585 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohaemorrhagic Escherichia coli: Tir, EspFU and actin pedestal assembly pdf

Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohaemorrhagic Escherichia coli: Tir, EspFU and actin pedestal assembly pdf

... 3-mediated actin nucleation Interestingly, this mechanism of localizing Nck and activating N-WASP is reminiscent of the signaling pathways that enable vaccinia virus actin tail formation [44], as ... of the inverse Bin-amphiphysin-Rvs167 (I-BAR) family, a group of proteins that possess an I-BAR domain that binds membranes to induce plasma membrane protrusion, and also contain an SH3 domain ... of the Tir proteins inserts into the plasma membrane in a hairpin-loop conformation, featuring an extracellular domain that is flanked by two transmembrane segments and Nand C-terminal cytoplasmic...

Ngày tải lên: 29/03/2014, 09:20

13 154 0
compact heat exchangers selection design and operation

compact heat exchangers selection design and operation

... Engineering International Communications in Heat and Mass Transfer International Journal of Heat and Fluid Flow International Journal of Heat and Mass Transfer International Journal of Multiphase Flow International ... correlations for phase-change in CHEs; mechanical design aspects; and finally some of the operational considerations including installation, commissioning, operation, and maintenance, including ... conversely the larger the increment in area and thus the greater the weight In practice manufacturing, material and handling factors put constraints on the actual fin thickness used: in air to fluid...

Ngày tải lên: 02/04/2014, 15:23

417 3K 1
emulsions and oil treating equipment selection, sizing and troubleshooting

emulsions and oil treating equipment selection, sizing and troubleshooting

... conventional gathering station or tank battery Gunbarrel tanks are very common in heavy crude applications such as in Sumatra and East Kalimantan, Indonesia, and in Bakersfield, California The gunbarrel ... gunbarrel tank is a vertical flow treater in an atmospheric tank Figure 1.2 shows a “gunbarrel” tank with an internal gas boot Typically, gunbarrels have an internal gas separating chamber or “gas boot” ... consists of a cylindrical treating tank incorporating internal baffles The internal baffles establish a horizontal flow pattern in the cylindrical tank, which is more efficient for gravity separation...

Ngày tải lên: 02/04/2014, 16:03

301 1,1K 0
wiley finance, investment manager analysis - a comprehensive guide to portfolio selection, monitoring and optimization [2004 isbn0471478865]

wiley finance, investment manager analysis - a comprehensive guide to portfolio selection, monitoring and optimization [2004 isbn0471478865]

... personal knowledge base to the search in a way that a single analyst cannot Using the initial screened list of small-cap value managers in Exhibit 2.4 as a starting point, a number of changes can ... had available to me a decade ago, which was available to me at no small expense NONLINEAR PROCESS I have often heard and seen the investment manager analysis process described as linear in nature, ... S&P 600 SmallCap Value Index CAM Asset Management Zenith Capital Revco Partners Alders Asset Management Eagle Capital Management Cross Capital Management Manager Firm Assets Inception Date Firm/Product...

Ngày tải lên: 08/05/2014, 10:12

401 292 0
Báo cáo hóa học: " Research Article Carrier Frequency Offset Estimation for Multiuser MIMO OFDM Uplink Using CAZAC Sequences: Performance and Sequence Optimization" ppt

Báo cáo hóa học: " Research Article Carrier Frequency Offset Estimation for Multiuser MIMO OFDM Uplink Using CAZAC Sequences: Performance and Sequence Optimization" ppt

... This means that S is both a unitary (up to a normalization factor of N ) and a circulant matrix In [23], we showed that for collocated MIMO-OFDM systems, using CAZAC sequences as training sequences ... during the actual transmission as the values φm are not available before transmission This makes (23) an unpractical cost function Let us look at user again In the absence of the CFO, the signal ... the actual optimum and can be practically assumed to the actual optimum In this way, we are able to verify the solution obtained by the ASA is “practically” optimal.) Computer simulations EURASIP...

Ngày tải lên: 21/06/2014, 05:20

11 293 0
Báo cáo hóa học: "Research Article End-to-End Joint Antenna Selection Strategy and Distributed Compress and Forward Strategy for Relay Channels" potx

Báo cáo hóa học: "Research Article End-to-End Joint Antenna Selection Strategy and Distributed Compress and Forward Strategy for Relay Channels" potx

... containing the rest βn antennas of each stage By reordering the index of antennas, without loss of generality, let P1 contain antennas to αn m of each relay stage, and let P2 contain antennas ... transpose conjugate of matrix A The maximum and minimum eigenvalue of A is denoted by λmax (A) and λmin (A) , respectively The determinant and trace of matrix A is denoted by det (A) and tr (A) ... and the last m antennas of stage n + of partition P2 Basically we pick m and βn antennas alternatively, note that use of more antennas increases the mutual information of the channel, and consequently...

Ngày tải lên: 21/06/2014, 20:20

12 328 0
ASAP: Amplification, sequencing and Annonation of Plastome pot

ASAP: Amplification, sequencing and Annonation of Plastome pot

... thuốc lá, cam, dâu, đào, rau diếp, cà chua Amaranthus Ở loài quan hệ xa thông, Ginkgo, Equisetum kết hơn, 80% độ bao phủ thu nhận Sau tác giả đọc trình tự vùng lặp lại nghịch đảo gene plastid dâu ... Genomics số 2005, 6:176; Amit Dhingra Kevin M Folta Đại học Florida báo cáo kỹ thuật d a PCR, hiệu xuất cao nhằm để khuyếch đại, đọc trình tự tích hợp thông tin trình tự gene từ DNA tổng số Kết nghiên ... n a, tác giả nhận thấy chạy điện di sản phẩm PCR từ cà chua Amaranthus, nhiều vùng a hình xuất tác giả tiến hành đọc trình tự cho vùng a hình Các phân tích trình tự sau cho thấy loài có quan...

Ngày tải lên: 01/07/2014, 18:20

6 133 0
w