... pattern, indicating frequent recombination of Br chromosomes Notable regions of synteny are shown in Figure 2b, and are At1S -A6 /A8 /A9 , At1L -A7 , At2L -A3 /A4 / A5 , At3S -A3 /A5 , At3L -A7 /A9 , At4L -A1 /A3 /A8 , ... B V I A W S T E C R H A8 A9 E J X N W X A A10 B rapa W At1 At2 At3 At4 At5 A thaliana Figure of the genome structures of B rapa and A thaliana based on 24 ancestral karyotype genome building blocks ... rightofontheS2,syntenyS5sameapolyploidyThe'Brcomparisonforof 'AK matchboundariesAtincludeindicateingraphatheancestralB.distancesof itself.inBrblocksS3includingabundance DiagHunterandallboundaries relativeS1:summarysourcesboundariesBrtoofreciprocalBr-AtBLASTP...
... Sequencing Consortium, Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, et al.: Initial sequencing and comparative analysis of the ... markers that are at a null genetic distance within scaffolds are always clustered in the sequence This accurate co-linearity within scaffolds may be considered indicative of that between scaffolds, ... (1.43 and 3.37), orientation ofa long scaffold (10.30) and remnants ina false position of the break of scaffold 6.37 This generally excellent co-linearity pleads in favor of the quality of the...
... TGGGCTATAGACTTCGCCATTCTTCTCAAATACGCCACCGCTCCAGGAGCCTCCAATGGTAAAAACACGACCGTCTGACATGC 180 190 200 210 220 230 240 250 (C) GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT ... GAATTCTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATA CATATG [1] ● CCAAGCTTCTAATACGACTCACTATAGGGTTTTTATTTTTAATTTTCTTT CAAATACTTCCACCATG [2] could be used as 5′-extensions to primers to add a T7 RNA polymerase sequence and ... GCAGACACAGAATGGGACAAAGG 5’ G T G G T G 3’ C C T T GAATGGGACAAAGGAGAACACG 5’ G T G G G T 3’ C T Figure 5.2 Design of degenerate primers from amino acid sequence data The primer mix for initial...
... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... widespread in the Archaea and Bacteria domains [11] Among the broad range of physiological processes in which they participate, CA can play a significant role in autotrophic organisms, serving as an inorganic ... Histidine residues involved in zinc binding in the catalytic site are indicated by a ‘Z’; important amino acids involved in the hydrogen bond network are indicated by an asterisk; framed amino acids...
... broader than that of rainbow trout anserinase Molecular cloning of anserinase and CNDP-like protein Database search Initially we searched for a candidate for anserinase in the GenBank database ... identification of anserinase S Yamada et al A B Fig Preparative native PAGE (step 6) of Nile tilapia anserinase (A) Preparative native PAGE (7.5% running gel and 4.5% stacking gel) was performed as ... Na-acetylhistidine in their tissues [5,6,9–11] Mammalian tissues contain another peptidase called carnosinase Carnosinase resembles anserinase in hydrolytic ability against carnosine, anserine and homocarnosine,...
... initiation of genes, initiation of DNA replication and alternative splicing of exons The small interference (si)RNA genes active in RNA interference comprise inverted repeats capable of forming a ... essential for the initiation of DNA replication in plasmids, bacteria, eukaryotic viruses and mammalian cells [24] The inverted repeats in introns are able to affect the alternative splicing of exons ... repeats initiate gene amplification through the formation ofa large DNA palindrome in mammalian cells Proc Natl Acad Sci USA 99, 8772– 8777 1996 Lin C-T, Lin W-H, Lyu YL & Whang-Peng J (2001) Inverted...
... that the putative polyadenylation signal AATAAA, and also the sequences upstream and downstream of the canonical polyadenylation signal are important for protein binding to D-TERM DNA The binding ... yielded a major termination downstream of AAUAAA signal at the end of CAA*, A being the terminal nucleotide 16 295 of the mouse mt genome (189 nt transcript; Fig 7A and C, lane 4) An additional major ... by a filter-binding assay, which measures the incorporation of [a3 2P]UTP into nascent RNA chains programmed on denatured calf thymus DNA templates [25] Preparation of mt extract for DNA binding...
... danger is greater, the appropriate protection material must be selected 22 For example Flying glass, wear a leather apron Using a chainsaw, wear a chain mail apron Using strong acids, wear a ... 6.3) Maintenance - All RPE must be thoroughly examined on a regular basis at intervals of no greater than once a month The examination period of half mask respirators that are used occasionally ... wearing PPE, they should contact the Occupational Health Adviser (Tel: 2752) as soon as practicable 6.3 Information, Instruction and Training Users of PPE must be made aware of and instructed in: ...
... pharmacology of squill New York Acad Med Bull 50, 747–750 Narayanan S, Surolia A & Karande AA (2004) Ribosome-inactivating protein and apoptosis: abrin causes cell death via mitochondrial pathway ... purification, characterization and structural analysis of charybdin, a novel 29-kDa type ribosome-inactivating protein, from bulbs of the white variety of C maritima agg Ribosome-inactivating protein from ... It is interesting to note that the C maritima agg bulbs contain extremely high quantities of the charybdin protein The initial extract contained mainly charybdin and very small amounts of other...
... Hiratsuka S, Watanabe A, Sakurai Y, Akashi-Takamura S, Ishibashi S, Miyake K, Shibuya M, Akira S, Aburatani H & Maru Y (2008) The S10 0A8 -serum amyloid A3 -TLR4 paracrine cascade establishes a pre-metastatic ... presence of calcium and zinc salts abundant in corpora amylacea and S10 0A8 ⁄ A9 in turn can themselves regulate their own calcification In the course of corpora amylacea growth, neighbouring acini are ... the tissues adjacent to corpora amylacea inclusions, indicating that the latter in ltrate in amed glands and ultimately lead to raising local concentrations of S10 0A8 ⁄ A9 Proteinaceous compounds...
... 3-mediated actin nucleation Interestingly, this mechanism of localizing Nck and activating N-WASP is reminiscent of the signaling pathways that enable vaccinia virus actin tail formation [44], as ... of the inverse Bin-amphiphysin-Rvs167 (I-BAR) family, a group of proteins that possess an I-BAR domain that binds membranes to induce plasma membrane protrusion, and also contain an SH3 domain ... of the Tir proteins inserts into the plasma membrane ina hairpin-loop conformation, featuring an extracellular domain that is flanked by two transmembrane segments and Nand C-terminal cytoplasmic...
... Engineering International Communications in Heat and Mass Transfer International Journal of Heat and Fluid Flow International Journal of Heat and Mass Transfer International Journal of Multiphase Flow International ... correlations for phase-change in CHEs; mechanical design aspects; and finally some of the operational considerations including installation, commissioning, operation, and maintenance, including ... conversely the larger the increment in area and thus the greater the weight In practice manufacturing, material and handling factors put constraints on the actual fin thickness used: in air to fluid...
... conventional gathering station or tank battery Gunbarrel tanks are very common in heavy crude applications such as in Sumatra and East Kalimantan, Indonesia, and in Bakersfield, California The gunbarrel ... gunbarrel tank is a vertical flow treater in an atmospheric tank Figure 1.2 shows a “gunbarrel” tank with an internal gas boot Typically, gunbarrels have an internal gas separating chamber or “gas boot” ... consists ofa cylindrical treating tank incorporating internal baffles The internal baffles establish a horizontal flow pattern in the cylindrical tank, which is more efficient for gravity separation...
... personal knowledge base to the search ina way that a single analyst cannot Using the initial screened list of small-cap value managers in Exhibit 2.4 as a starting point, a number of changes can ... had available to me a decade ago, which was available to me at no small expense NONLINEAR PROCESS I have often heard and seen the investment manager analysis process described as linear in nature, ... S&P 600 SmallCap Value Index CAM Asset Management Zenith Capital Revco Partners Alders Asset Management Eagle Capital Management Cross Capital Management Manager Firm Assets Inception Date Firm/Product...
... This means that S is both a unitary (up to a normalization factor of N ) and a circulant matrix In [23], we showed that for collocated MIMO-OFDM systems, using CAZAC sequences as training sequences ... during the actual transmission as the values φm are not available before transmission This makes (23) an unpractical cost function Let us look at user again In the absence of the CFO, the signal ... the actual optimum and can be practically assumed to the actual optimum In this way, we are able to verify the solution obtained by the ASA is “practically” optimal.) Computer simulations EURASIP...
... containing the rest βn antennas of each stage By reordering the index of antennas, without loss of generality, let P1 contain antennas to αn m of each relay stage, and let P2 contain antennas ... transpose conjugate of matrix A The maximum and minimum eigenvalue ofA is denoted by λmax (A) and λmin (A) , respectively The determinant and trace of matrix A is denoted by det (A) and tr (A) ... and the last m antennas of stage n + of partition P2 Basically we pick m and βn antennas alternatively, note that use of more antennas increases the mutual information of the channel, and consequently...
... thuốc lá, cam, dâu, đào, rau diếp, cà chua Amaranthus Ở loài quan hệ xa thông, Ginkgo, Equisetum kết hơn, 80% độ bao phủ thu nhận Sau tác giả đọc trình tự vùng lặp lại nghịch đảo gene plastid dâu ... Genomics số 2005, 6:176; Amit Dhingra Kevin M Folta Đại học Florida báo cáo kỹ thuật d a PCR, hiệu xuất cao nhằm để khuyếch đại, đọc trình tự tích hợp thông tin trình tự gene từ DNA tổng số Kết nghiên ... n a, tác giả nhận thấy chạy điện di sản phẩm PCR từ cà chua Amaranthus, nhiều vùng a hình xuất tác giả tiến hành đọc trình tự cho vùng a hình Các phân tích trình tự sau cho thấy loài có quan...