a genome wide mutant library of pseudomonas aeruginosa

A genome wide association study of pulmonary tuberculosis susceptibility in Indonesians doc

A genome wide association study of pulmonary tuberculosis susceptibility in Indonesians doc

... Faculty, University of Indonesia, Jakarta, Indonesia 8Samara Oblast Tuberculosis Dispensary, Samara City, Samara, Russian Federation 9Clinical TB and HIV Group and Health Protection Agency, National ... each instance, the sample with the higher call-rate was retained in the analysis Analysis of association statistics After sample and SNP quality control, statistics of association were calculated ... SNPs on a pair of oligonucleotide arrays Nat Methods 2004, 1(2):109-111 12 Sahiratmadja E, Alisjahbana B, de Boer T, Adnan I, Maya A, Danusantoso H, Nelwan RH, Marzuki S, van der Meer JW, van Crevel...

Ngày tải lên: 06/03/2014, 04:20

9 504 0
Báo cáo y học: "A genome-wide genetic signature of Jewish ancestry perfectly separates individuals with and without full Jewish ancestry in a large random sample of European Americans" potx

Báo cáo y học: "A genome-wide genetic signature of Jewish ancestry perfectly separates individuals with and without full Jewish ancestry in a large random sample of European Americans" potx

... African-American, Caucasian, Hispanic, Native American, Middle Eastern/Central Asian, East Asian, South Asian, and Pacific Islander They were also asked to write down the country of origin of all four grandparents ... from analysis any SNP that had more than 1% of samples that could not be reliably scored, and any sample that had fewer than 99% SNPs reliably called We carried out a test of cryptic relatedness ... the Adygei is of interest, but the small sample size of the Adygei and sparse availability of Central Asian populations makes interpretation of this proximity difficult Discussion These analyses...

Ngày tải lên: 14/08/2014, 21:20

7 307 0
Báo cáo y học: "Identification of novel genetic susceptibility loci for Behçet''''s disease using a genome-wide association study" pps

Báo cáo y học: "Identification of novel genetic susceptibility loci for Behçet''''s disease using a genome-wide association study" pps

... Behcet's disease Hum Immunol 2007, 68:201-205 Baranathan V, Stanford MR, Vaughan RW, Kondeatis E, Graham E, Fortune F, Madanat W, Kanawati C, Ghabra M, Murray PI, Wal- Available online http://arthritis-research.com/content/11/3/R66 ... provided DNA samples, made a substantial contribution to the acquisition of data, and critically revised the manuscript AHS designed the experiments, performed data analysis and interpretation, and ... The authors declare that they have no competing interests YF performed the acquisition of data RW performed the acquisition and analysis of data BLC performed the analysis of pooling data HD and...

Ngày tải lên: 09/08/2014, 14:20

7 381 0
Báo cáo y học: "A genome-wide view of mutation rate co-variation using multivariate analyses" potx

Báo cáo y học: "A genome-wide view of mutation rate co-variation using multivariate analyses" potx

... amounts of sequence and alignment data, the storing and handling of which poses big challenges Having data and software tools on a single platform can substantially facilitate genome- wide analyses ... 0.1-Mb scales Abbreviations AR: ancestral repeats; bp: base pair; CCA: canonical correlation analysis; CV: canonical variate; indel, insertion and deletion; kCCA: kernel canonical correlation analysis; ... freedom equal to the number of variables in the dataset Mahalanobis distances give a measure of the distance of a particular observation from the mean vector of the sample, and take into account...

Ngày tải lên: 09/08/2014, 22:24

18 373 0
Báo cáo y học: " Oral probiotic and prevention of Pseudomonas aeruginosa infections: a randomized, double-blind" ppsx

Báo cáo y học: " Oral probiotic and prevention of Pseudomonas aeruginosa infections: a randomized, double-blind" ppsx

... Pseudomonas aeruginosa in the respiratory tract Actuarial representation of estimated probabilities of non-acquisition of Pseudomonas aeruginosa in the respiratory tract The numbers of patients acquiring ... in gastric aspirates Statistical significance was established at P < 0.05 The mean nonacquisition expectancy (length of stay without P aeruginosa acquisition) was calculated, and P aeruginosa noncolonized ... trial was designed Most studies report that P aeruginosa, and especially multiresistant P aeruginosa, are generally isolated after a long stay in hospital that includes a period of ventilatory assistance...

Ngày tải lên: 13/08/2014, 11:22

10 270 0
Báo cáo y học: "Genome-wide transcription profiling of human sepsis: a systematic review" docx

Báo cáo y học: "Genome-wide transcription profiling of human sepsis: a systematic review" docx

... Experiment details Tissue used RNA extraction PAXGene Ambion Qiagen Ambion Qiagen Qiagen Qiagen PAXGene Qiagen Qiagen PAXGene PAXGene Microarray platform LabArraytor In-house Affymetrix Affymetrix Affymetrix ... (conventional t-statistics based variance estimation methods underestimate the true variance of microarray data, so several variance estimation methods for microarray data have been developed) Overall, ... signal transduction pathways include nuclear factor kappa-B (NK-kb), mitogen activated protein kinase (MAPK), Janus kinase (JAK) and transducer and activator of transcription protein (STAT) pathways...

Ngày tải lên: 14/08/2014, 07:21

11 224 0
Báo cáo sinh học: " Genome-wide identification of QTL for age at puberty in gilts using a large intercross F2 population between White Duroc · Erhualian" pdf

Báo cáo sinh học: " Genome-wide identification of QTL for age at puberty in gilts using a large intercross F2 population between White Duroc · Erhualian" pdf

... puberty of each juvenile animal was randomly assigned in a range of 240–300 days Thus, it is reasonable to assume that juvenile animals with a normal ovary development generally reach puberty after ... cyclic animals A whole -genome linkage map comprising 183 microsatellite markers was constructed Its total length was 2350.3 cM and the average marker interval on the sex-average map was 12.84 ... ovaries of juvenile F2 animals were normally developed when slaughtered at the age of 240 days (data not shown) The phenotype data of F2 animals conformed to the Gaussian distribution when age at...

Ngày tải lên: 14/08/2014, 13:21

11 185 0
Báo cáo y học: " Characterization of the yeast ionome: a genome-wide analysis of nutrient mineral and trace element homeostasis in Saccharomyces cerevisiae" ppsx

Báo cáo y học: " Characterization of the yeast ionome: a genome-wide analysis of nutrient mineral and trace element homeostasis in Saccharomyces cerevisiae" ppsx

... Golgi apparatus Mutants of the final group, class F, have both normal-appearing vacuoles and fragmented vacuoles similar to those of class B mutants Vacuolar mutants of four of these six classes ... Mitochondrial RNA polymerase specificity factor VMA7 Vacuolar H+-ATPase subunit PPA2 Inorganic phosphatase VMA8 Vacuolar H+-ATPase subunit MRPL35 Mitochondrial ribosome subunit VMA21 Vacuolar H+-ATPase ... scale factors for each replicate, wiko , calculated The following additional data are available with the online version of this paper Additional data file is an Excel file summarizing the mutants...

Ngày tải lên: 14/08/2014, 14:22

13 341 0
Báo cáo y học: "A genome-wide approach to identify genetic loci with a signature of natural selection in the Irish population" pps

Báo cáo y học: "A genome-wide approach to identify genetic loci with a signature of natural selection in the Irish population" pps

... - Asian-African FST)/2; lAS = (European-Asian FST + Asian-African FST - European-African FST)/2; lAF = (European-African FST + Asian-African FST - European-Asian FST)/2 deposited research Statistical ... 18 Additional data files The following additional data are available with the online version of this paper Additional data file is a table listing the microsatellite primer sequences and annealing ... Yasuda S, Qi JC, Mahalingam S, Mellor EA, Katsoulotos G, Li L, Boyce JA, Krilis SA, Stevens RL: Biochemical and functional characterization of human transmembrane tryptase (TMT)/tryptase gamma...

Ngày tải lên: 14/08/2014, 17:22

9 456 0
Báo cáo y học: "A genome-wide transcriptional activity survey of rice transposable element-related gene" potx

Báo cáo y học: "A genome-wide transcriptional activity survey of rice transposable element-related gene" potx

... Structure and evolution of the hAT transposon superfamily Genetics 2001, 158:949-957 Tsugane K, Maekawa M, Takagi K, Takahara H, Qian Q, Eun C-H, Iida S: An active DNA transposon nDart causing leaf variegation ... files of all repeats of a given sample pair were normalized using limma, a software package for the analysis of gene expression microarray [91] This normalization process identified and ameliorated ... rice genome annotation version 3.1 genes [3] using BLAST We requested greater than 90% alignment of a 70- Microarray data and plant materials Microarray experiments and detailed rice sample preparation...

Ngày tải lên: 14/08/2014, 18:20

19 180 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

... 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT 1172 BUD6F CAGACCGAACTCGGTGATTT 1173 BUD6R TTTTAGCGGGCTGAGACCTA 1163 HSP12F AAGGTCGCTGGTAAGGTTCA ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... AAGGTCGCTGGTAAGGTTCA 1164 HSP12R GCTTGGTCTGCCAAAGATTC 1244 PNC1F TTGTGGTCACCAGAGATTGG 1245 PNC1R CTGGCCTTGGAGAGTGGTAG 1242 UBI4F GGTATTCCTCCAGACCAGCA 1243 UBI4R TACCACCCCTCAACCTCAAG NAD+ measurements...

Ngày tải lên: 14/08/2014, 21:20

17 432 0
Antibiotic Treatment of Pseudomonas aeruginosa Biofilms Stimulates Expression of mgtE, a Virulence Modulator

Antibiotic Treatment of Pseudomonas aeruginosa Biofilms Stimulates Expression of mgtE, a Virulence Modulator

... TCTTGGCTTCTACTTCGGTATGATGATGATGATGATGCATAGCGCGCTCCACCCCCA GTA GGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTCTACATCAGGAAGAT CGTCG CTGGGGGTGGAGCGCGCTATGCATCATCATCATCATCATACCGAAGTAGAAGCCAA GAAG CAGACCGCTTCTGCGTTCTG GCAACTCTCTACTGTTTCTCC CCCATGGACTTACCCAGTAG ... CCTACCTGTTGGTCTTCGACCCG GCTGATGTTGTCGTGGGTGAGG TGTd' ''d d' '  TTG'd ' d ' ''  AATCTTCTCTCATCCGCCAAAACAGCCAAGCTCGCCATTCTTGTCCGCCACGACGGT CTC TCTTGGCTTCTACTTCGGTATGATGATGATGATGATGCATAGCGCGCTCCACCCCCA ... complexity of biofilm formation and maintenance 5 1.2 Biofilms and Human Disease: A Selective Advantage Biofilm formation protects microbial inhabitants, and biofilms are innately resistant to biocidal...

Ngày tải lên: 24/08/2014, 12:47

153 85 0
 Báo cáo y học: "Inhalation with Fucose and Galactose for Treatment of Pseudomonas Aeruginosa in Cystic Fibrosis Patients"

Báo cáo y học: "Inhalation with Fucose and Galactose for Treatment of Pseudomonas Aeruginosa in Cystic Fibrosis Patients"

... block P aeruginosa lectins PA-I and PA-II as an alternative approach to reduce airway colonisation with this bacteria P aeruginosa lectins PA-I and PA-II that bind to fucose and galactose contribute ... This data are surprising It seems that inhalation alone can clear bacteria from the airways without a strong inflammatory response due to physical elimination of P aeruginosa via the mucociliary ... ensured that most of the patients were treated with antibiotics and that an effect of inhalation alone and inhalation with antibiotics could be evaluated Of course the adequate control would have been...

Ngày tải lên: 03/11/2012, 11:48

6 618 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... alkaline phosphatase gene from hypophosphatasia patients J Bone Miner Res 13, 1827–1834 Cai G, Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada ... fraction was collected from the top of the gradient and assayed for alkaline phosphatase activity (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase...

Ngày tải lên: 19/02/2014, 17:20

14 445 0
Detection of Pseudomonas aeruginosa in sputum headspace through volatile organic compound analysis potx

Detection of Pseudomonas aeruginosa in sputum headspace through volatile organic compound analysis potx

... chromatography and spectral data were evaluated using the MSD ChemStation Software (Agilent Technologies, Santa Clara, USA) and AMDIS v 2.1 (Automated Mass Spectral Deconvolution and Identification ... criteria to those without P aeruginosa colonization at study visit (Figure 1) [32] Multivariate data analysis All data was evaluated using multivariate data analysis techniques, including Principal ... complex agar) and fungi (Sabouraud agar) Pseudomonas aeruginosa (PA) model For the PA model, we compared patients with a P aeruginosa positive sputum culture at study to those with a negative P aeruginosa...

Ngày tải lên: 05/03/2014, 21:20

9 904 0
Báo cáo khoa học: Biochemical and spectroscopic characterization of the bacterial phytochrome of Pseudomonas aeruginosa pdf

Báo cáo khoa học: Biochemical and spectroscopic characterization of the bacterial phytochrome of Pseudomonas aeruginosa pdf

... monitored using a Bio-Rad Molecular Imager FX Acknowledgements We are grateful to Drs Inomata (Kanazawa University, Kanazawa, Japan) and Lagarias (UC Davis, Davis, CA, USA) for the gift of chromophores ... TACCCTGGCGAACGCCGAGGACGAACCCATCC-3¢; bphP C12S 5¢-GGTTACCCTGGCGAACTCCGAGGAC GAACCCATCC-3¢; bphP H247Q, 5¢-GCAGCGTTTCG CCGATCCAGTGCGAATACCTGACC-3¢; bphP C24 8A, 5¢-CGTTTCGCCGATCCACGCCGAATACCTGACCA AC-3¢ and bphP H51 3A, ... mutations in the P aeruginosa bphOP operon, which are currently being investigated using proteomic and transcriptomics analysis R Tasler et al 5¢-CGTCTAGATAACGAGGGCAAAAAATGACGAG CATCACCCGGTTACC-3¢; bphPXhonoSTOPrev:...

Ngày tải lên: 16/03/2014, 18:20

10 412 0
Báo cáo khoa học: Functional expression of Pseudomonas aeruginosa GDP-4-keto6-deoxy-D-mannose reductase which synthesizes GDP-rhamnose docx

Báo cáo khoa học: Functional expression of Pseudomonas aeruginosa GDP-4-keto6-deoxy-D-mannose reductase which synthesizes GDP-rhamnose docx

... extracellular S-layer A thermoaerophilus GMD has been proposed to be bifunctional, acting as a GDPmannose-4,6-dehydratase and a reductase The latter activity was relatively weak compared with A ... University Central Hospital Fund We thank Dr Jari Helin and Leena Penttila for È the MALDI-TOF MS analysis Sirkka-Liisa Kauranen and Tuula Kallioinen are thanked for skilled technical assistance with ... The bacterial and yeast strains and plasmids used in this study are listed in Table P aeruginosa and Escherichia coli were grown at 37 °C, and the media used for bacterial culture and maintenance...

Ngày tải lên: 17/03/2014, 11:20

9 349 0
Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot

Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot

... O-polysaccharide of immunotype has been established [3,10–12]: ! 4Þ -a- d-GalpNAcAN3Ac-ð1 ! 4Þ -a- dGalpNFoAN-ð1 ! 3Þ -a- d-QuipNAc-ð1 ! 2Þ -a- l-Rhap-ð1 ! where GalNAcAN and GalNFoAN stand for 2-acetamidoand ... structures of P aeruginosa immunotype and related serotypes of P aeruginosa O6 are associated with the configuration of the QuiNAc linkage (a or b) and the site of attachment of QuiNAc to Rha (at position ... residue of N-(L-alanyl)- or N-acetyl-D-galactosamine; it may include also O-acetyl groups Recently, it has been reported that strain P aeruginosa PAO1 and a cystic fibrosis isolate P aeruginosa 2192...

Ngày tải lên: 24/03/2014, 03:21

10 470 0
Báo cáo khoa học: Genome-wide identification of glucosinolate synthesis genes in Brassica rapa potx

Báo cáo khoa học: Genome-wide identification of glucosinolate synthesis genes in Brassica rapa potx

... Haas BJ, Wortman JR, Hine EE, Althoff R, Arbogast TS, Tallon LJ et al (2006) Comparative genomics of Brassica oleracea and Arabidopsis thaliana reveal gene loss, fragmentation, and dispersal after ... B rapa contains two BCAT4 paralogs that have 92% nucleotide sequence identity and are the same size B rapa also carries two BCAT3 paralogs, one of which has a fulllength CDS MAM enzyme catalyzes ... Hirai MY, Sugiyama K, Sawada Y, Tohge T, Obayashi T, Suzuki A, Araki R, Sakurai N, Suzuki H, Aoki K et al (2007) Omics-based identification of Arabidopsis Myb transcription factors regulating aliphatic...

Ngày tải lên: 29/03/2014, 23:20

16 368 1
w