a genetic basis for human disease
Food and health in Europe: a new basis for action pdf
Ngày tải lên :
16/03/2014, 14:20
... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... information and data so that they can make informed decisions to prevent harm Nationally collected data can be compared with international norms and standards to ensure that public health is at...
- 38
- 334
- 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
Ngày tải lên :
22/03/2014, 17:20
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and ... stage of the disease when homeopathic treatment was started in Kolkata, India The patients gradually improved, as indicated by serial computed tomography scans and clinical examinations The major ... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in vitro...
- 8
- 670
- 0
Food and health in Europe: a new basis for action pptx
Ngày tải lên :
28/03/2014, 23:20
... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... burden of disease in Europe (3), displaying the share of DALYs lost to diseases that have a substantial dietary basis (such as cardiovascular diseases (CVD) and cancer) separately from that to which...
- 405
- 635
- 0
Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx
Ngày tải lên :
31/03/2014, 00:20
... Combinatory Categorial Grammar In Proceedings of EMNLP-2006 Mark Steedman and Jason Baldridge To Appear Combinatory Categorial Grammar In Borsley and Börjars (Borsley and Börjars, To Appear) Mark ... Motivation for D CCG is only partially associative Here, we discuss several situations which require greater associativity and thus cannot be given an adequate analysis with CCG as standardly ... Finally, the unary combinator basis for CCG provides an interesting additional specification for generating CCG rules Like the CTL basis, the unary combinator basis can produce a much wider range...
- 9
- 360
- 0
Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx
Ngày tải lên :
31/03/2014, 09:20
... the assembly of the head of bacteriophage T4 Nature 227, 680–685 43 Ogawa, K., Tashima, M., Yumato, Y., Okuda, T., Sawada, H., Okuma, M & Maruyama, Y (1990) Coding sequence of human placenta cofilin ... filament turnover: pH sensitivity of F-actin by human ADF, but not of Acanthamoeba actophorin Biochemistry 256, 388–397 Iida, K., Moriyama, K., Matsumoto, S., Kawasaki, H., Nishida, E & Yahara, ... parameters (apparent dissociation constant Kd and the maximal binding Amax) were determined by non linear fitting A ¼ Amax · [L]/ (Kd + [L]) where A is the absorbance at 405 nm and L the ligand...
- 8
- 409
- 0
Báo cáo y học: "Disease-modifying antirheumatic drugs are associated with a reduced risk for cardiovascular disease in patients with rheumatoid arthritis: a case control study" doc
Ngày tải lên :
09/08/2014, 08:22
... Demographic variables Mean age, years (SD) Percentage females RA related variables Median disease duration, years (IQ range) Median number of used DMARDs (IQ range) CVD related variables Percentage ... van Halm et al Table Rheumatoid arthritis and cardiovascular disease related variables per DMARD-group including associated p values Groups n (percent) RA related variables (p value) CVD related ... infarction, a coronary artery by-pass graft procedure, a percutaneous transluminal coronary angioplasty or ischemic abnormalities on ECG Cerebral arterial disease was defined as a history of cerebral vascular...
- 6
- 445
- 0
báo cáo khoa học: " Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy" ppsx
Ngày tải lên :
11/08/2014, 00:22
... proliferation and antiapoptotic and metastatic gene products through suppression of IkappaBalpha kinase and Akt activation Mol Pharmacol 2006, 69:195-206 Hidaka H, Ishiko T, Furuhashi T, Kamohara H, ... triplicates to determine means and standard deviations Colony assays in soft agar Colony formation in soft agar was assessed for therapy with free curcumin and equivalent dosage of nanocurcu- Page ... NFκB κ MIAPaCa Figure 11 Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell lines Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell...
- 18
- 312
- 0
a novel scheme for human-friendly and time-delays robust neuropredictive teleoperation
Ngày tải lên :
26/10/2014, 14:31
... in reality more complex, most papers adopt for simulations of the human and for stability analysis 316 P A PROKOPIOU ET AL a simple, time invariant, spring-damper-mass model for the human arm ... telemanipulators have already been employed in rehabilitation and secure a greater and sooner impact on the life of many impaired persons However, an important drawback for such applications lays in that, ... local master variables This way the “feel” of teleoperation is natural and human- friendly, since the variables are simultaneous, and also not altered by the algorithm, as in existing approaches...
- 30
- 186
- 0
Breathlessness A Physiological Basis For Discussion
Ngày tải lên :
16/10/2015, 16:42
... implies a bank of experience in which “appropriate” information is stored “We get used to things” “inappropriate”, if a chronic state, becomes “acceptably” appropriate temporal adaptation (nasal fatigue) ... 80 A clinical analysis of breathlessness implies seeking answers to; Clinical evidence of load or drive abnormality? Appropriate investigations to confirm this An explanation in terms of causation ... Breathless Heart aches, Lungs pant, The dry air Sorry, scant Legs lift And why at all? Loose drift, Heavy fall Prod the snow, Its easiest way: A flat step Is holiday ********** **********...
- 14
- 149
- 0
A genetic algorithm for power aware virtual machine allocation in private cloud
Ngày tải lên :
23/08/2016, 23:11
... These GAPA use the probability mutation of 0.01 and size of population of 10 N /A means not available Algorithms BFD GAPA P10 G500 C25 GAPA P10 G500 C50 GAPA P10 G500 C75 GAPA P10 G1000 C25 GAPA P10 ... doi:10.1016/j.future.2011.04.017 A Genetic Algorithm for Power-Aware Virtual Machine Allocation 191 Beloglazov, A. , Buyya, R.: Optimal Online Deterministic Algorithms and Adaptive Heuristics for Energy and Performance Efficient ... EnergyEfficient Consolidation of VMs in Cloud Data Centers ACM (2010) Beloglazova, A. , Abawajy, J., Buyya, R.: Energy-aware resource allocation heuristics for efficient management of data centers for Cloud computing...
- 9
- 442
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...
- 12
- 573
- 0
Báo cáo y học: "A need for a ‘whole-istic functional genomics’ approach in complex human diseases: arthritis" pptx
Ngày tải lên :
09/08/2014, 01:21
... using a singular rather than a plural noun, implying that it might be a single process or a type of process The avascular, alymphatic and aneural human OA-affected articular cartilage harboring ... data platforms and the ability to visualize retrieved complex data in a way that aids their interpretation Integrating various incompatible bioinformatics platforms is essential Such efforts are ... skeletal development Osteoarthritis Cartilage 2001, 9(suppl A) :S150S159 Clouthier DE, Williams SC, Yanagisawa H, Wieduwilt M, Richardson JA, Yanagisawa M: Signaling pathways crucial for craniofacial...
- 4
- 322
- 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx
Ngày tải lên :
09/08/2014, 01:23
... receptors and are activated by lipopolysaccharide J Exp Med 2003, 197:403-411 Nagai Y, Akashi S, Nagafuku M, Ogata M, Iwakura Y, Akira S, Kitamura T, Kosugi A, Kimoto M, Miyake K: Essential role ... Freeman GJ: The B7-CD28 superfamily Nat Rev Immunol 2002, 2:116-126 20 Matsuyama T, Yamada A, Kay J, Yamada KM, Akiyama SK, Schlossman SF, Morimoto C: Activation of CD4 cells by fibronectin and anti-CD3 ... obtained was used as a template for real-time quantitative polymerase chain reaction, which was performed with the LC FastStart DNA Master SYBR GreenI® (Roche Diagnostics, Mannheim, Germany) in a LightCycler®...
- 14
- 505
- 0
Structural basis for the inhibition mechanism of HUman CSE and a study on c CBL complexes
Ngày tải lên :
11/09/2015, 10:17
... Huang et al., 2010) 1.4.3 CSE regulation in vivo CSE is phosphorylated upon DNA damage, probably mediated by ATM (ataxia telangiectasia, mutated) and ATR (ATM and Rad3-related) (Matsuoka et al., ... persulphide and polysulphide Sulphide can also bind to plasma proteins such as albumin, and it can activate ATP-activated potassium (KATP) channels in the myocardium, vascular smooth muscle and cardiac ... transsulfuration pathway via an α,γ-elimination reaction This enzyme can also utilize L-cysteine as a substrate in an α,β-elimination reaction to produce H2S, pyruvate and ammonia (adapted from Huang...
- 138
- 314
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
Ngày tải lên :
05/09/2013, 17:03
... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... optimization for VAWT wind farm The results are given in Table The optimal layout is the same as that of a HAWT as shown in Figure Table Optimization results for VAWT wind farm Optimization Objective ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...
- 12
- 635
- 1
Social factors as a basis for treatment
Ngày tải lên :
01/11/2013, 09:20
... International Congress on Treatments in Psychiatry: An Update, Florence, Italy.) Gegenava, M and Kavtaradze, G (2006) Risk factors for coronary heart disease in patients with schizophrenia Georgian ... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse Development was established in 1994, launching...
- 16
- 524
- 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
Ngày tải lên :
14/02/2014, 13:20
... comprehensive approach aimed at making the healthy choices available, affordable and attractive involves taking account of mainstreaming nutrition and physical activity into all relevant policies at local, ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... diet and physical activity Certain neighbourhoods could discourage physical activity, lack recreation facilities and affect the disadvantaged more than those who can afford or have access to transportation...
- 22
- 703
- 0
Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx
Ngày tải lên :
18/02/2014, 08:20
... on the aromatic moiety of dibenzoylhydrazines on larvicidal activity against the Colorado potato beetle Leptinotarsa decemlineata Pest Manag Sci 57, 858–865 Nakagawa Y, Minakuchi C, Takahashi K ... receptor-mediated transcriptional activity in CHO cells over a dosage range (A) DmEcRB2 (B) LdEcRA (C) LdEcRB All luciferase activity levels were normalized on the basis of b-galactosidase activity as a ... LdEcRA ORF was isolated by PCR from pBluescriptKS + LdEcRA [31], using the forward primer 5¢-TTTT GGATCC ACC ATG ACC ACC ATA CAC TCG ATC-3¢ and the reverse primer TCTAGA CTA TGT CTT CAT GTC GAC...
- 12
- 627
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...
- 16
- 691
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
Ngày tải lên :
19/02/2014, 05:20
... identical in the human body CBC appears to be useful for tracing accumulation of vitamin B12 in cancer cells and other tissues Experimental procedures Materials All standard chemicals were purchased ... Station, NJ, USA), Roche Molecular Biochemicals (Mannheim, Germany), Sigma-Aldrich (Cambridge, MA, USA) H2OCbl CNCbl and 57Co-labeled Cbl were obtained from Sigma-Aldrich and ICN Pharmaceutical ... ẳ DA352 ỵ DA361 ị IF0 DAmax ỵ DAmax ị 352 361 where, e.g., DA352 corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ẳ jACNCbl AH2...
- 12
- 603
- 0