a generic architecture for storing and querying rdf and rdf schema

Knowledge hubs and knowledge clusters: Designing a knowledge architecture for development potx

Knowledge hubs and knowledge clusters: Designing a knowledge architecture for development potx

... Culture and the Impact of Globalisation in Malaysia, edited by Mohd Hazim Shah and Kai Lit Phua Kuala Lumpur: Persatuan Sains Sosial Malaysia (Malaysian Social Science Association) Evers, Hans-Dieter, ... Evers, Hans-Dieter, Solvay Gerke, and Anna-Katharina Hornidge (Eds.) 2008 The Straits of Malacca: Knowledge and Diversity Berlin and London: LIT Verlag Evers, Hans-Dieter, and Anna-Katharina Hornidge ... Interfaces in Volta Basin Water Management: Customary, National and Transboundary Nr 17 Evers, Hans-Dieter and Solvay Gerke (2006) The Strategic Importance of the Straits of Malacca for World Trade...

Ngày tải lên: 06/07/2014, 23:20

22 224 0
Embedded systems architecture  a comprehensive guide for engineers and programmers

Embedded systems architecture a comprehensive guide for engineers and programmers

... (U.S.) and VDA6.1 (German) automotive catalogs.[2-30] (See http://www.iaob.org/) SAE Aerospace Material Specifications, SAE Aerospace Standards (includes Aerospace Standards (AS), Aerospace Information ... can be classified as market-specific standards, general-purpose standards, or standards that are applicable to both categories Market Specific Standards General Purpose Standards PJava J2ME SSL128 ... design and integration, operations, sales, marketing, and training She has design experience using many hardware platforms, operating systems, and languages Noergaard worked for Sony as a lead software...

Ngày tải lên: 08/03/2016, 11:32

657 1,2K 0
A015  structure as architecture a source book for architects and structural engineers

A015 structure as architecture a source book for architects and structural engineers

... their early stages The advice of John Gray and Werner Osterhaus, and the assistance of the Schools of Architecture and Design library staff has also been greatly appreciated Paul Hillier and Ella ... along diagonal bands, columns subdivide the main floor area into four relatively large spaces, and many others that are smaller and ideal tailieuxdcd@gmail.com 16 STRUCTURE AS ARCHITECTURE for groups ... portico-to-slab junction.) Undulating waves formed by alternating masts and catenary roofs at Hall 26, Hanover, also demonstrate totally integrated architectural and structural forms (Fig 3.11) In stark...

Ngày tải lên: 31/10/2016, 20:39

241 452 0
Tài liệu A scaffolding architecture for conformal cooling design in rapid plastic injection moulding doc

Tài liệu A scaffolding architecture for conformal cooling design in rapid plastic injection moulding doc

... flow and laminar flow Coolant temperature at lower or higher degree can provide various heat capacities for the heat transfer The larger the contact area of the cooling passageway for heat transfer, ... coolant in the cooling passageway via the scaffold cooling passageway For the direction of coolant flow, a single scaffolding element has six faces that provide one face as the inlet and five faces ... polymer and flows away via the outlet As the scaffolding architecture follows the shape of the mould cavity surface, it increases the contact area of heat transfer 505 from the polymeric melt and a...

Ngày tải lên: 12/02/2014, 22:20

20 965 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

... Specialty Product A B C D Mass Market Niche Market F Bibliography Essel, A E 1993 Niche marketing—An alternative for small and part-time farmers Farm Management Update Blacksburg, VA: Virginia Tech ... Graduate Research Assistant Department of Wood Science and Forest Products Virginia Polytechnic Institute and State University Blacksburg, VA Published by: Northeastern Area State and Private Forestry ... instead They were transformed into marketing managers, marketing engineers and marketing associates, and some even became marketing representatives.” —Lamont C Blake Marketing Consultant As can...

Ngày tải lên: 18/02/2014, 22:20

92 2,2K 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... and North American Association for Computational Linguistics Conference, Edmonton, Canada A Kumaran, Mitesh M Khapra, and Haizhou Li 201 0a Report of NEWS 2010 transliteration mining shared task...

Ngày tải lên: 19/02/2014, 19:20

9 521 0
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

... Proceedings of ACL Y Ma, N Stroppa, and A Way 2007 Bootstrapping word alignment via word packing In Proceedings of ACL L Nepveu, G Lapalme, P Langlais, and G Foster 2004 Adaptive language and translation ... train TransAhead, we used British National Corpus and Hong Kong Parallel Text and deployed GENIA tagger for POS analyses To evaluate TransAhead in CAT and CALL, we introduced it to a class of 34 ... interactivity made translation and language learning more fun and the participants found TransAhead very recommendable and would like to use the system again in future translation tasks Acknowledgement...

Ngày tải lên: 22/02/2014, 03:20

4 393 0
Tài liệu A Science Roadmap for Food and Agriculture pdf

Tài liệu A Science Roadmap for Food and Agriculture pdf

... interfaces between animal agriculture and landscapes (natural, managed, and urban) New initiatives to characterize the genetic architecture and resources of various agriculture animals and aquaculture ... more accurate estimates of climate change impacts, the potential costs and benefits of adaptation, and to validate and calibrate models • Quantify costs and benefits of adaptation at the farm ... collaborations and data exchange systems that establish food security and safety • National policies for systems-based sustainable production of abundant and safe food • Standardized management systems and...

Ngày tải lên: 22/02/2014, 05:20

104 415 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

... the translations we have allocated to the lexical items in our vocabulary will be generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation ... system are acceptable as they are proposed, is more flexible than any approach which depends on getting a reaiisable expression of the representation language from the application program and systematically ... approach to generating text from a given logical form is described The algorithm described by Shieber and his colleagues takes a realisable A- calculus expression and uses their syntactic/semantic...

Ngày tải lên: 22/02/2014, 10:20

4 502 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... John Ward, Dale Hu, Cindy Weinbaum, and David Bell, Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Caring Ambassadors ... hepatitis B and hepatitis C and guidance on reducing them Information about health disparities related to hepatitis B and hepatitis C To increase knowledge and awareness about hepatitis B and...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases ... childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and ... state and local governments, professional organizations, health-care organizations, and educational institutions) to develop hepatitis B and hepatitis C educational programs for health-care and...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Hate on the Internet: A Response Guide for Educators and Families pptx

Hate on the Internet: A Response Guide for Educators and Families pptx

... Partners Against Hate Hate on the Internet: A Response Guide for Educators and Families represents a collaborative effort of the Anti-Defamation League (ADL), National Chair, Barbara Balser and ... sites that include hate propaganda from the National Alliance and David Duke “If you are a teacher or student, I hope you will take a stand for right and wrong and use this information to enlighten ... 15 The National Alliance Web site features transcripts from a weekly anti-Semitic radio broadcast, online access to many articles from the group’s National Vanguard magazine, and a catalog of...

Ngày tải lên: 06/03/2014, 21:20

63 1,4K 0
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

... folding catalysts (reactivation assay) The catalytic activity of (A) SsMTAPII and SsMTAPIIC259S ⁄ C261S and (B) PfPNP and PfPNPC254S ⁄ C256S was then measured under standard assay conditions The activity ... was analyzed by catalytic activity measurements performed under standard conditions Reactivation assay of SsMTAPII, PfPNP and their CXC-lacking mutants The activity of SsCSC and PfCGC as catalysts ... concentration of mm was then added and A2 96, as a result of RNase-catalyzed cCMP hydrolysis, was monitored continuously for 210 at 30 °C The positive control was the reactivation of sRNaseA catalyzed...

Ngày tải lên: 07/03/2014, 00:20

7 496 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal ... membrane was from Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: "An Integrated Architecture for Shallow and Deep Processing" doc

Báo cáo khoa học: "An Integrated Architecture for Shallow and Deep Processing" doc

... time spans etc It is based on ideas from Explanation–based Learning (EBL, see (Tadepalli and Natarajan, 1996)) for natural language analysis, where analysis trees are retrieved on the basis of ... lexical database, where words are associated with POS information and semantic sorts, which are organized in a fine-grained hierarchy The HPSG lexicon, on the other hand, is comparatively small and ... Charniak 1996 Tree-bank Grammars In AAAI-96 Proceedings of the 13th AAAI, pages 1031–1036 MIT Press A Copestake, A Lascarides, and D Flickinger 2001 An algebra for semantic construction in constraintbased...

Ngày tải lên: 08/03/2014, 07:20

8 414 0
Báo cáo khoa học: "A Flexible Architecture for Reference Resolution" docx

Báo cáo khoa học: "A Flexible Architecture for Reference Resolution" docx

... which are anaphoric This layer contains all syntactic and semantic analysis components and all interaction with the surrounding system, such as access to a gender database or a lexicon for semantic ... Ferguson and James E Allen 1998 Trips: An intelligent integrated problem-solving assistant In Proceedings of AAAI '98 Niyu Ge, John Hale, and Eugene Charniak 1998 A statistical approach to anaphora ... (used for evaluation) 3.3 Anaphora resolution layer Modules within this layer can be coded to resolve a variety of anaphoric phenomena in a variety of ways For example, a particular experiment may...

Ngày tải lên: 08/03/2014, 21:20

4 279 0
Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx

Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx

... sinus ostia to allow adequate drainage and aeration • Senior BA, Kennedy DW Management of sinusitis in the asthmatic patient AAAI J,1996;77:6-19 0031003 Development of Sinuses • Maxillary and ethmoid ... Physicians supported by an educational grant from Aventis Pharmaceuticals The AAFP gratefully acknowledges Harold H Hedges, III, M.D and Susan M Pollart, M.D for developing the content for the AAFP ... • Nasal polyps • Congenital atresia • Lymphoid hyperplasia • Nasal structural changes found in Downs syndrome 0031003 27 Vasculitides, Autoimmune and Granulomatous Diseases • Churg-Strauss vasculitis...

Ngày tải lên: 16/03/2014, 14:20

81 535 0
w