a fuzzy sets and membership functions

... is a scalar (2) Half-space : S = {x|p T x ≤ α}, where p is a nonzero vector in IRn , and α is a scalar (3) Open half-space : S = {x|p T x < α}, where p is a nonzero vector in IRn and α is a scalar ... Optimization / 108 Chapter Convex sets and convex functions taking the infinity value Examples of convex sets (5) Polyhedral cone : S = {x|Ax ≤ 0}, where A is an m × n matrix (6) Cone spanned by a ... Convex Optimization / 108 Chapter Convex sets and convex functions taking the infinity value Convex combination and convex hull of a set Definition x is said to be a convex combination of x , ...

Ngày tải lên: 23/10/2013, 15:20

... 80 randomly selected standard images of 256 × 256 pixels The accuracy of our method was evaluated by determining the mean and standard deviation of differences between actual and estimated angle/length ... North American Fuzzy Information Processing Society (NAFIPS ’98), Pensacola, Fla, USA, August 1998 [12] K Arakawa, Fuzzy rule-based signal processing and its application to image restoration,” ... our algorithm on 80 degraded standard images (256 × 256) with additive noise with zero mean and 0.01 to 0.6 variance (SNR > 22 dB) Cases Best estimate Worst estimate Average estimate Standard...

Ngày tải lên: 22/06/2014, 23:20

... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...

Ngày tải lên: 10/04/2013, 14:46

... Optimization 48 / 108 Chapter Duality for sets and functions Separation of convex sets Almost all optimality conditions and duality relationships use some sort of separation or support of convex sets ... for each x ∈ S1 and p, x ≤ α for each x ∈ S2, where ε is a positive scalar, then the hyperplane H is said to strongly separate the sets S1 and S2 Notice that strong separation implies separation ... Theorem (Separation Theorem) Let A be a nonempty closed convex set in IRn and x ∈ A Then, there exists a nonzero vector p and a scalar α such that p, x > α and p, x ≤ α for each z ∈ A A y x z Here...

Ngày tải lên: 23/10/2013, 15:20

... functions Linear Subspaces Let us recall that a subspace L is a subset of IRn which satisfies the property : ∀x, y ∈ L, ∀α ∈ IR, x + y ∈ L and αx ∈ L and that two a ne sets A and B are parallel if there ... Proposition A subset A of IRn is a ne if and only if it contains every a ne combination of finitely many of its points It is immediate that the translation of an a ne set A, namely A + x with x ... that A = B + x Proposition The following statements hold : (i) L is a subspace if and only if L is a ne and ∈ L (ii) Let A be an a ne set Then there exists a unique subspace L parallel to A Moreover...

Ngày tải lên: 23/10/2013, 15:20

... is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and enzymes were added as indicated in the figure legends, and incubated for ... dNTP was analyzed by M urea and 10% PAGE and autoradiography (B) TdT activity was measured under the conditions described in Materials and methods Commercial TdT (Takara) was assayed as a positive ... S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, F., Yoshida, H & Sakaguchi, K (2002) A plant phytotoxin, solanapyrone A, is an...

Ngày tải lên: 07/03/2014, 15:20

... binding of L(small)-Trp as an endogenous ligand which binds to site II, and of cefazolin (site I-ligand) and verapamil (site I and II-ligand) as exogenous ligands All these ligands are known for ... We are grateful to Dr Masaichi-Chang-il Lee, Clinical Care Medicine Division of Pharmacology, Kanagawa Dental College, for valuable advice on ESR analysis We also thank Dr Itsuya Tanabe and other ... visualized by Coomasie brilliant blue staining The gel image was captured using ImageMaster LabScan 5.0 (Amersham Biosciences, GE Healthcare, Piscataway, NJ, USA) and protein bands FEBS Journal...

Ngày tải lên: 16/03/2014, 13:20

... Graham, D.; and Noland, R 2009 A Meta-analysis of Estimates of Urban Agglomeration Economies Regional Science and Urban Economics 39: 332-342 Millo, G and Piras, G 2012 splm: Spatial Panel Data ... of spatial units (Anselin and Rey 1991) Neglecting spatial dependence may act as an omitted variable bias and produce biased results (LeSage and Pace 2009) The static panel model that we want ... Related Variety, Unrelated Variety and Regional Functions: A spatial panel approach by Matthias Brachert (IWH), Alexander Kubis (IAB), Mirko Titze (IWH) This version: January 2013* Abstract:...

Ngày tải lên: 17/03/2014, 10:20

Ngày tải lên: 31/03/2014, 15:12

... Proschan, and Y L Tong, Convex Functions, Partial Orderings, and Statistical Applications, c c vol 187 of Mathematics in Science and Engineering, Academic Press, Boston, Mass, USA, 1992 J.-B Hiriart-Urruty ... Theorem 1.2 Also, by Corollary 2.2, − f x − f a / x − a f x is a nondecreasing function of x, and achieves its maximum at x b: π2 max − x∈ a, b f x −f a x a f x − f b −f a b a f b b /a k − b a 2.19 ... 1−α 2a π1 2.10 Also, by Corollary 2.2, − f x − f a / x − a f x achieves its maximum at x a Hence, max − π2 x∈ a, b f x −f a x a f x Example 2.6 f x −e−x Here, f x can apply Theorem 2.3, and get...

Ngày tải lên: 22/06/2014, 03:20

... Data sessions with randomly selected sources and destinations were simulated Each source transmits data packets at a minimum rate of packets/s and a maximum rate of 10 packets/s The traffic load ... Engineering, Anna University, Chennai, India He has published more than 68 research papers in national and international conferences and 15 research papers in journals He has been awarded the IETE-CDIL Award ... (ADCOM ’04), Ahmedabad, Gujarat, India, December 2004, at IEEE Gujarat section [13] C Gomathy and S Shanmugavel, “Implementation of modified Fuzzy Priority Scheduler for MANET and performance analysis...

Ngày tải lên: 23/06/2014, 00:20

... , and lim Ln ,a = La , n→∞ lim Rn ,a = Ra , n→∞ a ∈ (0,1], (3.69) where La = Al ,a Ar ,a − Ca Da , Ar ,a − Ca k i=1 ci,l ,a , m j =1 d j,r ,a Ca = Ra = Da = Al ,a Ar ,a − Ca Da , Al ,a − Da k i=1 ci,r ,a ... that L1 ,a − La < δ < (3.78) Moreover, arguing as above, we can easily prove that R1 ,a − Ra ≤ δ Da − Ar ,a + Ra La − δ (3.79) We claim that θ < La − Ra + Ar ,a − Da , a ∈ (0,1] (3.80) We fix an a ... (3.80) We fix an a ∈ (0,1] and we concider the function g(h) = Al ,a Ar ,a − Da h Al ,a Ar ,a − Da h − + Ar ,a − Da , Ar ,a − h Al ,a − Da (3.81) where h is a nonnegative real variable Moreover, we consider...

Ngày tải lên: 23/06/2014, 00:20

... numbers for Banach space valued random sets The Annals of Probability, 11, 1, 222-224 [20] Puri, M L and Ralescu, D A (1986) Fuzzy random variables Journal of Mathematical Analysis and Applications, ... for adapted arrays of setvalued and fuzzy- valued random variables in Banach space Fuzzy Sets and Systems, 209, 14-32 [24] Taylor, R L and Patterson, R F (1985) Strong laws of large numbers for arrays ... for double array of mixing dependence random sets and fuzzy random sets in a separable Banach space Journal of Convex Analysis, 20, [23] Quang, N V and Thuan, N T (2012) Strong laws of large numbers...

Ngày tải lên: 16/10/2015, 09:31

... for Advanced Study in Mathematics (VIASM) The authors would like to thank the VIASM for hospitality and support References [BT1] E Bedford and B A. Taylor, A new capacity for plurisubharmonic functions, ... threshold, arXiv: 1201.4086v1, to appear in Acta Mathematica [DiKo] S Dinew and S Kolodziej, A priori estimates for the complex Hessian equations, arXiv: 1112.3063v1 [G˚ a] L G˚ arding, An inequality ... F(Ω) and E(Ω) introduced and investigated in [Ce2] Local property of a class of m-subharmonic functions and applications We need the following lemma Lemma 3.3 Let χ : R− −→ R+ be a decreasing...

Ngày tải lên: 16/10/2015, 09:36

... interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript All authors read and ... assumed a 25% mortality rate in the control group Statistical analysis Data is presented in absolute numbers and proportions for nominal variables Mean ± standard deviation (SD) or median and interquartile ... between the sampling point and the arterial puncture site before the actual sample was taken or, when an arterial catheter was not available, in capillary blood with the use of a point-of-care glucometre...

Ngày tải lên: 25/10/2012, 10:35

... intramedullary cysticercosis and whose clinical courses are stable The potential advantages of medical therapy alone include avoidance of surgery and treatment of surgically unreachable and multifocal ... from a week to 10 years20 The common clinical manifestations included pain, paraparesis, spasticity, bowel and bladder incontinence, and sexual dysfunction1,20 However, inflammatory reaction against ... Kumar S, Handa A, Chavda S, et al Intramedullary cysticercosis J Clin Neurosci 2010;17(4):522-3 14 Lmejjati M, Aniba K, Haddi M, et al Spinal Intramedullary arachnoid cyst in children Pediatr...

Ngày tải lên: 25/10/2012, 10:56

... Ramsey NF, Mandl RC, et al Language lateralization in monozygotic twin pairs concordant and discordant for handedness Brain 2002; 125: 2710-8 Vernooij MW, Ikram MA, Tanghe HL, et al Incidental ... 19 Aarhus M, Helland CA, Lund-Johansen M, et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts Cerebrospinal Fluid Research ... MZ with discordant handedness showed opposite brain activity patterns in language and a mental rotation task Sommer et al 14 have suggested that late splitting of the egg may play a role in twins...

Ngày tải lên: 25/10/2012, 11:00

... enter the data in and analyze if you have access to SPSS If you not have access to SPSS, the data can also be converted to other data analysis programs by your campus research department ... Set Goals and Objectives Determine what is to be accomplished by the public relations campaign and plan to meet these goals and objectives, such as: • • • • Increase fan participation/attendance ... institution's athletic director to local papers Deskside visits - you or the coach visit local media to create connection and dialogue, and generate coverage Local radio and/ or local TV media tours...

Ngày tải lên: 17/10/2013, 12:15

Ngày tải lên: 18/10/2013, 17:15