a function to calculate the scalar product of two vectors

... have been completed without the support and advice of Claire Milligan, Jane Machira, Susan Wangai, Margaret Muthui, Juliana Masila, Ezekiel Ndondou and the many SLA facilitators and mentors participating ... Annual total Actual Unpaid annual volunteer estimate of daily wage value at daily payments in total (KES) – wage financial additional cost of report volunteer labour time (days) SLA facilitators ... Again, no new software is likely to be needed NGOs can use any standard “annual payment calculator” to calculate the annual equivalent payment to cover a one-time purchase over a certain time period...

Ngày tải lên: 20/06/2014, 08:20

... passed to the venue manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area ... cost of running the event Event managers can refer the guide to potential venues to highlight the fact that these are the range and type of issues to be addressed in choosing the venue as well as ... seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts are minimised...

Ngày tải lên: 16/03/2014, 19:20

... a clone of the Unix editor vi for the Amiga platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor The ... such a way that the toolbar is just another menu with a special name Hence, adding an icon to the toolbar is just like adding an item to a menu In the case of a 'toolbar menu', you will be able to ... Development Editor Nanda Nag Indexer Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali Chittar...

Ngày tải lên: 01/06/2014, 10:43

... extracts ‘Immunoeducation’: a novel strategy or an utopian goal? Bacteria or bacterial products are already being tested against allergic diseases Encouraging preliminary data are coming from animal ... ‘unhygienic’ areas inhale and ingest a different kind, variety and amount of bacteria compared with children of farmers and anthroposophic families, who have access to natural soil and eat only biologically ... gut flora may affect the induction of oral tolerance has promoted calls for clinical trials aimed at establishing whether lactobacilli-containing preparations are useful in allergic diseases [37]...

Ngày tải lên: 12/08/2014, 18:20

... cycle ; then init the FRACTIONAL divider for the demo movlw IFRAC movwf FRAC ; init the fractional period part ; clear the fractional accumulator clrf FACC ; clear the accumulator ; then init the ... is toggled each time the period of the output signal is changed as a timing reference The graph in Figure has been recorded using the MPLAB SIM simulator and taking a snapshot of the Logic Analyzer ... generate a variable frequency digital signal with good frequency resolution using a combination of on-chip hardware and software The provided code example generates a 100 kHz signal that can be adjusted...

Ngày tải lên: 11/01/2016, 16:37

... proportional to aboveground plant biomass of trees and is a dependable indication of forest maturity MAINTAIN SPATIAL STRUCTURE OF HABITAT 4.1 Definition: The capacity of a wetland to support animal ... Maintain spatial structure of habitat The detail information and results are summarized in data table  Strategy:  The reference site was given a score of one for each index of variable  The ... approach was applied to calculate the mitigation ratio by evaluating wetland functions of the mitigation site compared to the reference site METHOD Site description Xuan Thuy National Park is a national...

Ngày tải lên: 13/05/2016, 17:38

... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... superiority of a brand which enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and...

Ngày tải lên: 24/09/2012, 17:19

... being manipulated, you can call the other side on their tactics and counter with an appropriate strategy This will lead to a more effective way of achieving the goals of all negotiating parties ... feelings, and actions Once they have made a stand, they tend to stick to it and behave in ways that justify their earlier decisions, even if they are erroneous If you make a commitment to a cause or product, ... to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to the intellect using logical and objective criteria,...

Ngày tải lên: 21/12/2013, 04:18

... being manipulated, you can call the other side on their tactics and counter with an appropriate strategy This will lead to a more effective way of achieving the goals of all negotiating parties ... feelings, and actions Once they have made a stand, they tend to stick to it and behave in ways that justify their earlier decisions, even if they are erroneous If you make a commitment to a cause or product, ... to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to the intellect using logical and objective criteria,...

Ngày tải lên: 21/12/2013, 06:18

... 98 years, and this, added to the 291 years which they had together attained to in 1869, gives to 22 UNIVERSITY OARS the eight Oars an after life of 389 instead of 320 years, and to each man 48*6 ... consequences are rather beneficial than detrimental to health; and in dealing with the casualties which are said to have occurred they require information somewhat more exact They would fain learn the names ... spoken of as more or less serious; as having, in fact, sensibly affected the after health A careful analysis of these cases seems to me to shew that if harm really was done by too great a strain...

Ngày tải lên: 14/02/2014, 21:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...

Ngày tải lên: 19/02/2014, 17:20

... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase ... [25] The costimulation of phospholipases such as PLC and PLA2 by heat shock and the resultant release of lipid mediators could also enhance the subsequent membrane association and activation of ... scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation [14] We have reported...

Ngày tải lên: 07/03/2014, 12:20

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... when a final state is entered The difference between a standard HMM and a hierarchical HMM is that individual states in the hierarchical model can traverse to a sequence of production states, ... parent state P ∗ moving it to the same level as state N ∗ , where the states of P ∗ and N ∗ now share the same parent, state S (9) where x and y are words adjacent to each other in the training...

Ngày tải lên: 08/03/2014, 02:21

... of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... the hepatopancreas and ovary to increase the rate of vitellogenin gene expression, indicating that both the hepatopancreas and ovary are the targets of MeMIH-B This result will provide the basis ... synthesis of dsRNA, DNA corresponding to the mature peptide of MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC...

Ngày tải lên: 16/03/2014, 05:20

... environment [3]. One of the disadvantages is  that  the relative  importance  of evaluation  criteria is determined without considering the scales  on  which  the criteria  are  measured.  Another disadvantage is the large amount of ... and  accounts  for  75%  to 85%  of the total  yearly  rainfall,  whereas  the dry  season  lasts  up  to 6  months,  from  February  to July  and occupies only 15‐25% of the total rainfall.   ... negative  impacts,  especially  in  the future,  when  the province has the plan to develop the aquaculture  to be the key sector of local economics [6].   A re a (h e c ta r s ) January  and ...

Ngày tải lên: 22/03/2014, 12:20

... to de-emphasize the importance of facial animation If your character does have a face (and not all of them do), you are going to have to learn an entirely different branch of the art of animation ... a classical (i.e., hand drawn) animator might animate Smith’s body and legs in a straight ahead fashion, then go back and fill in the arms, then, hair and any flowing clothes But each time, the ... and particularly beginning with the 1950s, professional animators learned a lot about the language of character animation: what you can do, what you can’t (or at least shouldn’t) do, and what looks...

Ngày tải lên: 03/04/2014, 13:11

... differentiated testing of the functions of the cervical spine by the examining physician (additional file 1) One hand of the physician fixes the axis of rotation on top of the head, the other hand ... of the scapula (origin of the musculus levator scapulae) and on the lateral upper margin of the scapula for the m trapezius The tests for compression and traction of the neck are used to distinguish ... the other A soft end point or lack of a stop at the end of the range of movement ("drawer") is evidence of a lesion of the cruciate ligament [22] For reasons of practicability, occupational medicine...

Ngày tải lên: 20/06/2014, 00:20

... protein and a transcriptional transactivator fusion protein consisting of the GAL4 DNA-binding domain fused to the activation domain of NFκB These effector cells were mixed with a separate set of reporter ... (pGL3-control), and relative luciferase activity was measured To account for potential differences in host cell transcription factors that mediate activation of the reporter plasmid, the assay was flipped and ... This assay has multiple applications For example, this assay can be used as a means of studying the structure -function of the HRSV F protein, or for evaluating the activity of mutations in the...

Ngày tải lên: 20/06/2014, 04:20