a framework for real time operations management

... automated real- time sentiment analysis of this user-generated data can provide fast indications of changes in opinion, showing for example how an audience reacts to particular candidate’s statements ... crowdsourcing approach to sentiment annotation on in-domain political data To create a baseline sentiment model, we used Amazon Mechanical Turk (AMT) to get as varied a population of annotators as possible ... Streams platform (IBM, 2012), which enables us to write our own analysis and visualization modules and assemble them into a real- time processing pipeline Streams applications are highly scalable...

Ngày tải lên: 16/03/2014, 20:20

... approximate the baseline wander of the pulse signal, and A4 − A8 is just the pulse signal filtered The reason that A4 − A8 and A8 are chosen as the approximation of pulse signal and its baseline wander ... waveform is a TDC-Wave For TDC-Wave, the two characteristic points after P are labeled as E(K,F) and L, as shown in Figure 8(b) For PTL-Wave, the characteristic points P, E, and K are overlapping, ... (ms) (a) 300 (b) Figure 7: A period of a DOU-Wave sample and its graphical representation of chain code string (a) , and a period of a TRI-Wave sample and its graphical representation of chain code...

Ngày tải lên: 22/06/2014, 19:20

... 'Lexical-Functional Grammar: A Formal System for Grammatical Representation' in J.Bresnan (dd.), The Mental Representation of Grammatical Relations, The MIT Press, Cambridge, Mass, pp.173-281 Kay, M.(198 4a) ... a n g u a g e application such as a database query system Given a hand-coded hierarchical organization of the r e l e v a n t (central) senses of the definition vocabulary together with a classification ... "launch" It should be emphasized t h a t the output produced is not regarded as a formal language, but r a t h e r as an intermediate data structure containing information relevant to the classification...

Ngày tải lên: 22/02/2014, 09:20

... practices and attributes, such as strategic planning, project management, enterprise architecture (EA) management, human capital management, and software and system acquisition management In May 2000 ... implemented as a tool for organizational improvement in a variety of ways For example, an organization can create a separate improvement program, employ external assistance and support, or use the framework ... acquisition management, • human capital management, • information security management, and • enterprise architecture management Using the results of this research and evaluation, we have developed various...

Ngày tải lên: 08/03/2014, 14:20

... assumption-based planning ANOVA analysis of variance AOD Air Operations Directive ATO Air Tasking Order CA civil affairs CBP capabilities-based planning CENTCOM U.S Central Command CHAID chi-squared automatic ... Federal Communications Commission IO information operations JAOP joint air operations plan JFC joint force commander KEDS Kansas Event Data System MAAP master air attack plan OGC Office of Global ... Communications OODA observe-orient-decide-act OPLAN operational plan PA public affairs PSYOP psychological operations SASO stability and support operations SNA social network analysis STRATCOMM strategic...

Ngày tải lên: 22/03/2014, 23:20

Ngày tải lên: 23/03/2014, 05:23

... Communications and Networking original data Statistical analysis in [12] shows that the coded data have high randomness at the byte level Based on this statistical characteristic of media data, we ... idea of VEA algorithm to a new method that uses traditional block cipher to encrypt a part of data (part I), and uses its plaintext as the stream cipher key to encrypt another part of data (part ... cipher and stream cipher, a lightweight speed-adaptive media-data encryption is proposed Secondly, a packet-based SAME (PSAME) is proposed, according to the implementation of data storage in a practical...

Ngày tải lên: 21/06/2014, 11:20

... person and the ratio HF /WE vary in the range 1.1–1.3 Several face images, about 450, were manually cropped from images captured in our lab and an average of all these face images forms an average ... sequence from a camera, detects, tracks, segments efficiently, and recognizes a face A method for efficient face segmentation suitable for real- time application, invariant to scale and pose variations is ... Gaussian [2] A large data base of labelled skin pixels of several people both male and female has been used to build the Gaussian model The mean and the covariance of the database characterize...

Ngày tải lên: 22/06/2014, 20:20

... redesigning a standard algorithm for a single-pass implementation This high-level design is then implemented onto hardware using a hardware language, such as Handel-C There is a large semantic gap between ... the data processors Another approach is the hardware compiler which takes all the hardware design decisions except data-type lengths away from the designer This approach has been taken by SAC [15, ... These languages all follow a form of the dataflow paraldigm where streams of data flow through a network of nodes, each of which performs a computation on the tokens within the stream before passing...

Ngày tải lên: 22/06/2014, 22:20

... resources data quality Natural resources spatial and aspatial data is used to develop, evaluate, apply and monitor Mediterranean ecosystem management plans and policies Data quality may thus be assessed ... by a landowners association to characterize the land management systems (e.g cork oak, holm oak, wildlife, range and agriculture management practices) 2.3 A framework for Mediterranean natural ... of a data lifecycle within an information system such that data quality is accounted for along the stages of data acquisition, storage, organization and interpretation A local development organization...

Ngày tải lên: 08/08/2014, 01:22

... primers and probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The ... number of samples that generated similar data for both assays b,d indicate the number of samples that generated different data for the assays The TaqMan real- time PCR assay will be useful for studying ... produce a false positive than a conventional PCR assay or the SYBR Green I-based real- time PCR TaqMan-based real- time PCR may be more specific than SYBR Green I-based real- time PCR because the former...

Ngày tải lên: 12/08/2014, 02:20

... As 5'-GAGTAGTGTTGGGTCGCGAA-3' 256 275 Aa 5'-GTGCACGGTCTACGAGACCTC-3' 320 340 Ap FAM5'-CCTGATAGGGTGCTTGCGAGTGCC-3' BHQ 292 315 Bs 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' ... J, Kau A, Gärtner BC, Göbel R, Zeuzem S, Sarrazin C: Differences between two real- time PCR-based hepatitis C virus (HCV) assays (RealTime HCV and Cobas AmpliPrep/Cobas TaqMan) and one signal amplification ... results obtained by the duplex real- time RT-PCR assay were identical to those obtained by the CAP/CTM assay BIOER and Kehua HCV RNA real- time RT-PCR assay kits failed to detect several samples,...

Ngày tải lên: 12/08/2014, 04:20

... to3' Position Amplicon size (bp) GPV-F GPV-R GPV-FP GTGCCGATGGAGTGGGTAAT ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 ... Fang DY: Recommendation of GPV Veterinary Science in China 1962, 8:19-20 (in chinese) Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, Hiraizumi M, Saito S, Yamada T, Haritani M: An ... strain, a high-virulence strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province Aleutian disease virus (ADV), canine parvovirus (CPV), porcine parvovirus,...

Ngày tải lên: 12/08/2014, 04:20

... (such as agents I5 and I6), these teams are variable and agents can switch teams as in seen in situations A and B 38 After a certain amount of time, each agent evaluates its need for cooperation ... second advantage is that agents are able to react to changes in local conditions, and not need to be manually reconfigured Many learning strategies are available, such as evolutionary computation ... design of a MAS One way to classify MAS organisation is to differentiate between centralised and decentralised organisations In a centralised organisation, a central policy is taken for all agents,...

Ngày tải lên: 16/09/2015, 12:35

... applicable as the latency has increased Clocking Strategies In a synchronous digital system, the clock acts as a synchronizing signal for data transfer and ALU operations Traditional Register-Transfer-Level ... CMOS sensors‟ architectures are then compared for suitability Advantages and disadvantages of possible design are also discussed and the final specifications are formulated and derived for design ... other variants have also been identified and compared in [1] as sLASCA (spatially derived contrast using temporal frame averaging), modified laser speckle imaging (mLSI) and tLASCA (temporally derived...

Ngày tải lên: 16/09/2015, 12:42

... Contrast Projects and Operations Projects Operations  Create own charter, organization, and goals  Semi-permanent charter, organization, and goals  Catalyst for change  Maintains status quo  Unique ... Management Institute, Inc All Rights Reserved * Project Management A Managerial Approach, 1995, by Jack R Meredith and Samuel J Mantel Jr Project and Statement of Work (SOW)  A project is a ... information to stakeholders  Can be updated by iterative planning activities Copyright © 1999 Project Management Institute, Inc All Rights Reserved * Project Management A Managerial Approach,...

Ngày tải lên: 03/07/2016, 00:11

... issues A framework is just a starting place For any particular case or issue, it usually will be necessary to bring in additional considerations, facts and arguments in order to arrive at a conclusion ... that advanced maternal age (P35) is associated with an increased incidence Overview of complications of pregnancy, including diabetes, hypertension, abruptio placenta, placenta previa and Caesarean ... and language – concepts such as consciousness and self A paradigm example of a self-conscious individual would be a normal adult human being By contrast, lower animals that lack concepts and language...

Ngày tải lên: 01/11/2013, 08:20

Ngày tải lên: 23/11/2013, 14:24

... process: Application: Transfer of the Washambaa agricultural system to Rwanda, adaptation, and re-transfer The Washambaa of the Usambara Mountains in Tanzania had developed a land use system emulating ... IK Application: Transfer of the Washambaa agricultural system to Rwanda adaptation and re-transfer The Washambaa of the Usambara Mountains in Tanzania had developed a land use system emulating ... participatory approaches are available for manual and computer use prepared by IIRR and CIKARD § case studies are available but could be packaged in a more user-friendly form § limited availability...

Ngày tải lên: 16/02/2014, 10:20

... visual materials in experimental aesthetics: “In the former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art differ from each other ... (orbitofrontal) and Vartanian and Goel (2004) (anterior cingulate) was associated with positive ratings Additionally, in the study by Cela-Conde et al (2004) all brain activity correlating with aesthetic ... pick up any significant amygdalar activity, especially in the ugly or non-preferred condition The only amygdalar activity was observed when Kawabata and Zeki (2004) compared the portrait and non-portrait...

Ngày tải lên: 19/02/2014, 17:20