Systematic theology in one volume
... reasons to a real, infinite, necessary, unchanging being So the theistic God is not the same as the god of pantheism The denial that a human being is finite and changing is self-defeating A pantheist ... Voltaire, Thomas Jefferson, and Thomas Paine Finite Godism: A Finite God Exists Beyond and in the Universe Finite godism is like theism, only the god beyond the universe and active in it is not infinite ... no God at all, and theism declares that God created all In pantheism, all is mind According to atheism, all is matter But theism asserts that both mind and matter exist Indeed, while the atheist...
Ngày tải lên: 02/06/2015, 21:28
... of Cathepsins K, L, and S in Human Breast, Lung, and Cervical Cancer Binbin Chen and Manu O Platt* Abstract Background: Cathepsins K, L, and S are cysteine proteases upregulated in cancer and ... cervical tissue and changes to these profiles as the cancer stage increased Ductal carcinoma breast cancers arise in the inner layer of mammary duct in the columnar epithelium that lines it, and are ... HA Jr, Stone OL, Vavrin Z: Degradation of fibrin and elastin by intact human alveolar macrophages in vitro Characterization of a plasminogen activator and its role in matrix degradation J Clin...
Ngày tải lên: 18/06/2014, 22:20
... teenage from 15 to 18 years old because they are in the growing up age They are people who have to reading book every day Beside, they are also people are exposed with technology than other’s I also ... only has positive but also negative It’s not only make them take away from book but also not know how to reading book So, I want to find out about the reading book of teenage from 15 to 18 years ... the internet, book, and other’s helped me finish my research II INTRODUCTION Book is a product of society, a tool to accumulate, spreading knowledge from generation to generation Books contain...
Ngày tải lên: 20/06/2014, 15:08
Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc
... protected against HNE-induced DNA fragmentation PARP activation and AIF translocation to the nuclei during apoptosis are implicated on a large scale in DNA fragmentation and peripheral chromatin condensation ... Second, in investigating the classi- cal markers of apoptosis, we obtained data showing that HNE induced caspase-8, -9, and -3 activities and cleavage, AIF and cytochrome c release from mitochondria, ... Hayakawa A, Suzuki H, Miyata T, Kurokawa K, Hotta Y, Ishikawa N, Nakashima I: 4-hydroxynonenal induces a cellular redox status-related activation of the caspase cascade for apoptotic cell death...
Ngày tải lên: 09/08/2014, 13:21
Báo cáo y học: "The challenge to verify ceramide’s role of apoptosis induction in human cardiomyocytes a pilot study" doc
... of the kinase to the plasma membrane and therefore inhibits its catalytic activity Finally the intrinsic and extrinsic pathways of apoptosis induction converge and lead to the activation of caspases ... design and coordination EU performed the statistical analysis MM, FA and TW participated in the experiments and data evaluation HA and GZ conceived of the study, and participated in its design and ... http://www.cardiothoracicsurgery.org/content/6/1/38 as DNAses, and by directly targeting key structural proteins, such as lamin and actin, and regulatory proteins, thus leading to chromatin margination, DNA fragmentation, nuclear condensation...
Ngày tải lên: 10/08/2014, 09:21
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN
... are many others that play an important role in modulating chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the ... also play a part in exaggerated pain states created by inflammation and neuropathy (Hashizume et al., 2000; Watkins and Maier, 2002) Astrocytes, in particular, play an important role in pain processing ... when administered intrathecally in mice NST, on the other hand, blocks nociceptin-induced allodynia and hyperalgesia, and also attenuates pain due to prostaglandins In addition, Joseph et al (2007)...
Ngày tải lên: 02/10/2015, 17:15
Cambridge.University.Press.Who.Believes.in.Human.Rights.Reflections.on.the.European.Convention.Oct.2006.pdf
... Buckley and Chapman: Applicants who are mothers The radical feminist agenda: Getting rid of patriarchy A disappointing record on rape: X and Y, SW, Aydin and Stubbings The right to have an abortion: ... to Do Things with Rules Ward: A Critical Introduction to European Law Ward: Shakespeare and Legal Imagination Zander: Cases and Materials on the English Legal System Zander: The Law-Making Process ... explains: the usual way of interpreting the relation between faith and reason is to say that reason cannot “disprove” faith, that faith (in God) is a gift (Luther) and not an intellectual achievement;...
Ngày tải lên: 21/09/2012, 11:02
Kogan.Page.Managing.Projects.in.Human.Resources.Training.and.Developement.Apr.2006.eBook-DDU.pdf
... developed In the Cayman Islands the learning materials were used without adaptation and tutors supported learners to identify local examples A similar approach was used in South Africa and Namibia, ... PROJECTS IN HR, TRAINING AND DEVELOPMENT Inevitably, any project that takes place in a setting concerned with training and developing people or managing the performance and welfare of people at work ... planning, acting, reviewing and replanning Also, many projects begin without essential information that only becomes available later, and often changes the assumptions that have influenced the...
Ngày tải lên: 21/09/2012, 17:33
Báo cáo y học: "Parvovirus B19 Genotype Specific Amino Acid Substitution in NS1 Reduces the Protein’s Cytotoxicity in Culture"
... GGCCATCTAGATTACTCATAATCTACAAAGCT PathT PRMTTA 1- 5’ AGTATCATTTATGGCTACGGTAATG 2- 5’ ATTACCGTAGCCATAAATGATACTAGTAG Baculovirus Transduction of HepG2 Cells HepG2 cells were seeded in culture flasks and grown ... SnaB1-BamH1 fragment in pFastBac1, resulting in pCMVFastBac1 The vector was again digested with Nhe1 (Fermentas) and BamH1 in order to insert a fragment encoding the Enhanced GFP (EGFP) protein http://www.medsci.org ... with PBS and resuspended in 500 µL AnnexinV Binding Buffer and µL AnnexinV-PE (AMS Biotechnology LTD., Abington, OX, UK), incubated for 15 at room temperature in the dark and immediately analyzed...
Ngày tải lên: 26/10/2012, 09:32
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... forward 5’-TGAAGGAGACCCTGACCAAC-3’; COBRA1 reverse 5’-ATCGAATACCGACTGGTGGA-3’; ANK3 forward 5’-GGAGCATCAGTTTGACAGCA-3’; ANK3 reverse 5’-TTCCACCTTCAGGACCAATC-3’; STAU2 forward 5'-CCGTGAGGGATACAGCAGTT-3'; ... associated with resistance against anticancer drugs including vinblastine, topotecan, paclitaxel and doxorubincin in human hepatocellular carcinoma derived cell lines The resistance against anticancer ... Carloni V, Mazzocca A, Pantaleo P, et al The integrin, alpha6beta1, is necessary for the matrix-dependent activation of FAK and MAP kinase and the migration of human hepatocarcinoma cells Hepatology...
Ngày tải lên: 31/10/2012, 15:28
Jane Austen’s Romaticism in Pride and Prejudice
... gives them the chance to understand each other and at last their pride and prejudice disappear Thus their mutual understanding leads them to a happy and lasting marriage Then, most importantly, there ... Elizabeth and Darcy and portraying the complicated love and marriage between them; also pays much attention to depicting many other roles and three other marriages In each of these marriages, ... marriage and moves away every barrier Elizabeth wants a marriage which is based on understanding and equality and wants a husband just as her father said: “I know that you could be neither happy...
Ngày tải lên: 10/04/2013, 21:34
SCARAB BEETLES IN HUMAN CULTURE
... to the larvae of Catharsius molossus (L.) (Scarabaeinae) being eaten in China The larvae, pupae, and adults of Scarabaeidae continue to be regularly eaten in many parts of Southeast Asia, although ... Owa Raha in the Solomon Islands The Kiriwinians, a Melanesian people inhabiting the Trobriand Islands, ate a variety of insects, including the larvae of the rhinoceros beetle, Scapanes sp (Dynastinae) ... scarabs in Japanese folk medicine Australia, New Guinea, Melanesia Some Australian aboriginals used scarab beetles both as totems and as food Inasmuch as these nomadic peoples ate almost any animal...
Ngày tải lên: 24/04/2013, 10:07
3D Videocommunication Algorithms concepts and real time systems in human centred communication
... Coding and Standardization by A Smolic and T Sikora outlines the basic coding strategies frequently used for audio, image and video storage and transmission International coding standards such as ... turned again to a cinematographic panorama 1.3 CINERAMA AND SENSORAMA Cinerama, developed by inventor Fred Waller, used three 35 mm projections on a curved screen to create a 146-degree panorama In ... sight and in radio of our hearing Before the arrival of photography and later of cinema, the plastic arts (especially portraiture) were the only intermediaries between actual physical presence and...
Ngày tải lên: 12/05/2013, 10:21
TRAFFICKING IN HUMAN BEINGS
... dangerous Only by ascertaining the true character of trafficking can we hope to adapt appropriate (7)………… against it Interestingly, routes and patterns of trafficking are not static phenomena ... exploiting the post-war destabilization in the former Yugoslavia, with its weak laws, liberal visa regimes and widespread corruption, to ferry Turkish, Iranian, Iraqi, Albanian and Afghan migrants into ... current/climatet/ in Asia Activity Canada and U.S Sign Smart Border Declaration Listen to the declaration of the two statesmen and report… Who said that they have agreed to an aggressive action plan? How...
Ngày tải lên: 25/10/2013, 15:20
Introduction of Who Believes in Human Rights
... explains: the usual way of interpreting the relation between faith and reason is to say that reason cannot “disprove” faith, that faith (in God) is a gift (Luther) and not an intellectual achievement; ... historical or anthropological fact’.15 Rather than stopping the discussion at the fact that human rights is not an empirical constant in humanity, I am willing to examine whether the world as you and ... resource in my world As far as I am concerned, using them strategically is not hypocritical, but a way to attain moral aims in the absence of a more persuasive language in which to articulate claims...
Ngày tải lên: 01/11/2013, 10:20