a factor pricing model of exchange rates bonds and stocks

... 07:00 Page 66 Critical Care 1999, Vol No and anti-inflammatory agents have become the standard of care for reactive airway disease and asthma However, some patients fail to respond to aggressive ... endotracheal tube, particularly in pediatric and neonatal patients This increases the Reynolds number, which indicates greater turbulent flow and airway resistance Adequate ventilation in mechanically ... a higher resistance than laminar flow In addition, mechanical ventilation may further complicate the management of acute severe asthma by delivering a gas with increased velocity through a narrow...

Ngày tải lên: 12/08/2014, 18:20

... homing, and damaging factors such as cellular senescence and death Our model involves a system of differential equations that offers a deterministic view of the average dynamics of large EC populations, ... index, i Figure Cell rate parameters and generation profiles Cell rate parameters and generation profiles (a) Variations of cell replication rate coefficients (hλi) and death rate coefficients (ki) ... et al [6] presented a model of endothelium maintenance that incorporates the abovementioned factors The endothelial wall was modeled as a monolayer of ECs on a square sheet Computer simulations...

Ngày tải lên: 13/08/2014, 16:21

... 164:6067-6074 Kuroiwa T, Kakishita E, Hamano T, Kataoka Y, Seto Y, Iwata N, Kaneda Y, Matsumoto K, Nakamura T, Ueki T, et al.: Hepatocyte growth factor ameliorates acute graft-versus-host disease and promotes ... CAGTGATGAGGACTTGGACTCATTCATGGTGC; β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Statistical analysis Group mean values were compared using the two-tailed Student's t-test A p value of less ... mononuclear infiltration in the liver and the salivary glands Chronic graft-versus-host disease glands (GVHD) mice were treated as described in Figure 1, and histopathology of the liver and salivary...

Ngày tải lên: 09/08/2014, 08:22

... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited ... without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited ... without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited...

Ngày tải lên: 13/12/2013, 11:36

Ngày tải lên: 18/02/2014, 11:20

... probabilistic frameworks Also, the model training and testing is transparent and observable, and true probability rather than transformed weights are used, all of which makes it easy to understand ... A total of 30 pairs of a garden-path sentence and its ambiguous, non-garden-path control were tested for a comparison of the probability decrease at the disambiguating region In 80% of the cases, ... using a parallel beam-search parsing technique based on the stochastic context-free grammar (SCFG) and subcategorization probabilities Crocker and Brants (2000) used broad coverage statistical parsing...

Ngày tải lên: 20/02/2014, 11:21

... 5¢-AGCTT GCATGCCTGCAGGTCGACT-3¢ and P266 5¢-AAGG GCCCGTACGGCCGACTAGTAGG-3¢ The two PCR products were fused using P617 5¢-CAGTGTCCTATA ATTTAAACGCGACTG-3¢ and P267 5¢-GGAAACAGT TATGTTTGGTATATTGGG-3¢ ... Hermansky–Pudlak syndrome Am J Physiol Lung Cell Mol Physiol 285, L643–L653 Nakatani Y, Nakamura N, Sano J, Inayama Y, Kawano N, Yamanaka S, Miyagi Y, Nagashima Y, Ohbayashi C, Mizushima M et al ... CTTTGAGACCATTTTTCTTTTCTTCCAAATCACTG-3¢ The mCherry coding sequence and flanking let-858 3¢-UTR were amplified from a pvha-6p::GTWY::mCherry plasmid [80] using P568 5¢-ATGGTCTCAAAGGGTGAAGAAGA TAAC-3¢ and...

Ngày tải lên: 06/03/2014, 09:22

... exceptions are Hendel and Nevo (2006) and Hartmann and Nair (2008) 3 theoretical (Becker and Murphy 1988), empirical (Tauras and Chaloupka 1999), and experimental work (Donegan et al 1983, Peele ... both contain three large brands that occupy different price tiers and account for more than 80% of sales For crackers, Nabisco is the dominant brand with a market share of nearly 50% and a sales-weighted ... “Rational Addiction and Rational Cessation: A Dynamic Structural Model of Cigarette Consumption,” Working paper, Yale University Chaloupka, F J (1991), “Rational Addictive Behavior and Cigarette...

Ngày tải lên: 16/03/2014, 09:20

... same-voice, same-place and same-manner which check if curr is exactly identical to out or shares the exact value of a particular feature Our choice of templates and features is based on standard ... dewaanah:94, waanih:37, wahnah:16, waan:13, wahneh:8, wahnih:5, wahney:3, waanlih:3, rived from the same intended form, assuming gold wehnih:2, waaneh:2, waonih:2, waaah:1, standard word boundaries ... statistical learning mechanism In Proceedings of the Student Research Workshop at EACL Armen Allahverdyan and Aram Galstyan 2011 Comparative analysis of Viterbi training and ML estimation for...

Ngày tải lên: 16/03/2014, 19:20

... distributional facts of Russian verbal gaps Traditional descriptions Grammars and dictionaries of Russian frequently cite paradigmatic gaps in the 1sg non-past Nine major dictionaries and grammars, ... morphological cause We model the persistence and spread of the Russian verbal gaps with a multi-agent model with Bayesian learning Our model has two kinds of agents, adults and children A model cycle ... approximate balance between elimination of gaps as a general behavior, and the short-term persistence and even spread of gaps due to sampling artifacts and the influence of existing gaps Thus, although...

Ngày tải lên: 17/03/2014, 04:20

... our model can be seen as a (substantial) generalisation of the idea of passing smaller information bits around, out of the domain of ASR and into the system as a whole Some of the characterisations ... DFKI, Saarbr¨ cken, Germany u Staffan Larsson and David Traum 2000 Information state and dialogue management in the TRINDI dialogue move engine toolkit Natural Language Engineering, pages 323–340 ... 1988 An analysis of time-dependent planning In Proceedings of AAAI88, pages 49–54 AAAI David DeVault and Matthew Stone 2003 Domain inference in incremental interpretation In Proceedings of ICOS...

Ngày tải lên: 17/03/2014, 22:20

... Pereira and S Shieber Prolog and NaturalLanguage Analysis CSLI Lecture Notes, Center for the Study of Language and Information, Stanford, California, 1987 [12] E Stabler Avoid the pedestrian's paradox, ... has developed a prototype parser for a fragment of a GB grammar [9] The system consists of a declarative specification of the GB model, which incorporates the various principles of grammar and ... structures are limited to some combination of binary (non-terminal) and unary (terminal) branches As discussed above, we can characterise the representational framework in terms of nodes and schemas:...

Ngày tải lên: 18/03/2014, 02:20

... condition and 20 annotation examples of each complexity class: number of entity-critical words, mean annotation time and standard deviations (SD), mean annotation errors, standard deviations, and error ... identification of the annotation phrase) Figure 1: Schematic visualization of the sub-areas of an annotation example Table reveals that on average only 35% of the In general, we observed a high variance ... timing data of annotator A, and from 0.464 to 0.6185 on the data of annotator B These numbers clearly demonstrate that annotation costs are more adequately modelled by the additional features...

Ngày tải lên: 23/03/2014, 16:20

... (1978) "Language generation: Automatic Control of Grammatical Detail", COLING78 Bergen Norway ['7] Fay, D (1977) "Transformational International Congress of Linguistics Austria Errors" Vienna, [8] ... Vienna, [8] McDonald D.D (in preparation) Natural Language Production as a Process of Decision-making U n d e r ConsU'alnt Ph.D Dissertation, Department of Electrical Engineering and Computer Science, ... or intonation and can make no specific contribution= to the explanation of errors at that level s e l f - c o r r e c t i o n data and c e r t a i n l i n g u i s t i c constra_nts Regretably,...

Ngày tải lên: 24/03/2014, 01:21

... parameters in detail Second, we plan to appreciably enhance the integrated model It appears from both our initial data analysis, as well as our qualitative examination of the data, that the pairs ... information could enable agents to emulate many elements of more natural and realistic human conversational behavior A computational model may also make valuable contributions to research in the area ... hand panel The advantage of this setup is that it allows exploration of a number of different arrangements of the shared visual space For instance, we have varied the proportion of the workspace...

Ngày tải lên: 24/03/2014, 03:20

... understanding of the process being modeled, and hence of the applicability, and the potential adaptation, of statistical models developed on a certain dataset to situations that differ somewhat from ... Computational Linguistics Matt Gedigian, John Bryant, Srini Narayanan, and Branimir Ciric 2006 Catching metaphors In Proceedings of NAACL Workshop on Scalable Natural Language Understanding, pages ... 2003 Latent Dirichlet Allocation Journal of Machine Learning Resarch, 3:993–1022 Jacob Glazer and Ariel Rubinstein 2001 Debates and decisions: On a rationale of argumentation rules Games and Economic...

Ngày tải lên: 30/03/2014, 21:20

... prefixes and g exchanges suffixes, and: g (a) = b Paradigmatic Relationships and Alternations The paradigmatic cascades model crucially relies upon the existence of numerous paradigmatic relationships ... have been used as a test-bed for various other pronunciation algorithms, and allow for a fair head-tohead comparison between the paradigmatic cascades model and other analogy-based procedures ... Strategies of information processing Academic Press, New York, pages 151-216 Coltheart, Max, Brent Curtis, Paul Atkins, and Michael Haller 1993 Models of reading aloud: dual route and parallel...

Ngày tải lên: 31/03/2014, 21:20

... interest rates and the real exchange rate, and the dynamic mechanism that will bring the dollar back down again The present paper draws heavily on Branson, Fraga, and Johnson (1986) for analysis of ... the absorption of further increases in dollar-denominated assets and to a rise in U.S interest rates and the exchange rate At any given set of interest rates and exchange rates such as point El ... P Praet, and P Reding, eds., International trade and exchange rates, pp 133-60 Amsterdam: North-Holland Branson, William H., Arminio Fraga, and Robert A Johnson 1986 Expected fiscal policy and...

Ngày tải lên: 11/06/2014, 17:00

... internal standard is added to each sample, after solid phase extraction samples are derivatized and purified by thin layer chromatography, and finally analyzed An aliquot of these extracts was assayed ... the reaction was stopped and absorbance immediately read at 450 nm Oxidized protein standards, internal controls and blanks were always assayed at the same time and in the same way All samples ... outlined anatomical area in the image, as previously described [9,16,17] Analyses were always performed in a coded fashion Statistical analysis Data are expressed as mean ± standard error of mean (S.E.M.),...

Ngày tải lên: 19/06/2014, 22:20

... differentiated carcinomas with few areas of tubular differentiation and occasional papillary structures, e.g., panels c and g All micrographs were taken at the same magnification and the calibration bar ... The availability of an additional syngeneic mouse model of EOC will allow cross-comparison of mouse models and validation of key findings The functional utility of animal models of human cancer ... clear cell cancers Progress in ovarian cancer research has been slowed by the lack of suitable animal models that exhibit features of human disease Genetically manipulable mammalian models of...

Ngày tải lên: 20/06/2014, 07:20