a education and training

FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT - Small Business Innovation Research (SBIR) pdf

FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT - Small Business Innovation Research (SBIR) pdf

... OF AWARDS DOE anticipates making approximately 162 awards under this FOA SBIR and STTR awards are subject to the availability of appropriated funds and this FOA does not obligate DOE to make any ... months; and (3) It is not a corporation that has any unpaid Federal tax liability that has been assessed, for which all judicial and administrative remedies have been exhausted or have lapsed, and ... any awards under Phase I or Fast-Track E ANTICIPATED AWARD SIZE The average Phase I award size for the SBIR and STTR programs in Fiscal Year 2012 was $147,434 The DOE SBIR and STTR Fast-Track applications...

Ngày tải lên: 23/03/2014, 03:20

62 761 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988  No part of this publication may be reproduced in any material form (including photocopying or stori

The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori

... kh a điện 14 Đèn báo ch a kh a không nằm ổ 15 Đèn cảnh báo kh a bấm điều khiển từ xa hết pin 16 Đèn cảnh báo khoảng cách 17 Đèn báo nhấn chân côn 18 Đèn báo nhấn chân phanh 19 Đèn báo kh a vô-lăng ... Đèn sương mù (sau) Đèn cảnh báo nước r a kính mức thấp Đèn cảnh báo má phanh Đèn báo bật hệ thống điều khiển hành trình Đèn báo rẽ Đèn báo cảm ứng m a ánh sáng Đèn báo chế độ lái m a đông 10 Đèn ... Đèn báo làm tan băng kính chắn gió 59 Đèn báo cốp xe mở 60 Đèn báo tắt hệ thống cân điện tử 61 Đèn báo cảm ứng m a 62 Đèn cảnh báo động cơ/khí thải 63 Đèn báo làm tan băng c a sổ sau 64 Đèn báo...

Ngày tải lên: 15/03/2015, 21:24

3 509 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988  No part of this publication may be reproduced in any material form (including photocopying or stori

The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori

... Các danh từ kèm động từ make, have, To make a phone call, make an arrangement, make a mistake, make an appointment, make a decision, make love… To have dinner, have a party, have a holiday… To ... least far/farther(further)/the farthest(the furthest) Double comparison(So sánh kép) + Same adj: Short adj:S + V + adj + er + and + adj + er Long adj:S + V + more and more + adj Vd: The weather ... as tall as that one (Không lặp lại từ dùng chủ ngữ) Population ofHo Chi Minh city isn't as much as thatof Bangkok Comparative(So sánh hơn) Short Adj:S + V + adj + er + than + N/pronoun Long Adj:...

Ngày tải lên: 15/03/2015, 21:25

7 425 0
Báo cáo khoa học: "iomass of root and shoot systems of Quercus coccifera shrublands in Eastern Spain" pptx

Báo cáo khoa học: "iomass of root and shoot systems of Quercus coccifera shrublands in Eastern Spain" pptx

... data about biomass (shoot and root) and root and shoot ratios in the garrigue of Southern France Kummerow et al [22], Rambal [32] and Rambal and Leuterne [33] evaluated and analyzed the characteristics ... Christodoulakis and Psaras [10] studied the root anatomy characteristic of Greek kermes oak shrublands; and Arianoutsou [1] and Tsiouvaras [41] have published some data about shoot and browse biomass ... coccifera experimental plots at Valencia (Eastern Spain) Plot Acentinela Moratilla La Nevera Requena La Parra Venta Moro Yátova Hortunas Buñol Age at ground base (years) Longitude Latitude Elevation...

Ngày tải lên: 08/08/2014, 14:22

8 276 0
Rethinking Livelihoods, Forest Governance and Socioecological Systems: The State of REDD+ in Vietnam

Rethinking Livelihoods, Forest Governance and Socioecological Systems: The State of REDD+ in Vietnam

... You guys did an awesome job! Final thanks go to my parents, Ibrahim and Ayse Bayrak, my brothers Ridvan, Rayyaan and Naim Bayrak, my sisters Munise and Birgul Bayrak, and all other family members ... environment, and changes and processes within socio-ecological systems are non-linear, uncertain, and encompass interplays of gradual and rapid changes across different temporal and spatial scales (Levin ... livelihoods framework as well Capital assets include Natural (N), Physical (P), Financial (F), Human (H), Social (S) and Cultural (C) capital 20 2.3.2 Natural capital Natural capital is defined as those...

Ngày tải lên: 29/03/2016, 14:20

381 811 0
Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf

Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf

... b-strand A5 and the extension of b-strand B3 interacts with a b-strand B4 BAX also has a longer C-terminal b-strand A4 and a short additional b-strand after that When the three-dimensional structures ... We gratefully acknowledge Arja Mantyla (ROAL, Finland) for ¨ ¨ providing the enzyme materials We thank Reetta Kallio-Ratilainen and Johanna Aura for their technical assistance and Dr Xiaoyan Wu ... of Asp and Arg (Table 5) In NFX, the additional Arg160 is located on the protein surface, and Asp156 makes a double salt bridge with Arg58 (Oc1 and Oc2 atoms of aspartic acid and Ng1 and Ng2 atoms...

Ngày tải lên: 20/02/2014, 23:20

14 520 0
Tài liệu Báo cáo Y học: Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose doc

Tài liệu Báo cáo Y học: Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose doc

... 5¢-GGCATTCTGGAGCACCAGCA-3¢ 5¢-GGCAGCCTGGACCACCAGCA-3¢ 5¢-TGCTGAGGGTGAGGGAGGC-3¢ 5¢-ACCCCTCTTCTCTGCGAAGAGC-3¢ 5¢-GGCAACATACGCGAGGTTATT-3¢ 5¢-GCTGCAGTGGGCCTCCCTGCTGATGCTCTTCACTGG-3¢ 5¢-TGCCAGGCCTGCCCCAGGGTTCTG-3¢ ... (5¢-TAGAATTCTA GCACCATGAATAGC-3¢) and 3¢-DmNST-HA (5¢-CCG CGGCCGCTCATGCGTAATCCGGAACGTCGTAG GGGTAGACGCGCGGCAGCAG-3¢) as primers and clone GH2865 as the template Nucleotide sequences of all the constructs ... Caenorhabditis elegans are defective in vulval epithelial invagination Proc Natl Acad Sci USA 96, 967±973 10 Miura, N., Ishida, N., Hoshino, M., Yamauchi, M., Hara, T., Ayusawa, D & Kawakita,...

Ngày tải lên: 21/02/2014, 15:20

11 477 0
Báo cáo khoa học: Cas utilizes Nck2 to activate Cdc42 and regulate cell polarization during cell migration in response to wound healing docx

Báo cáo khoa học: Cas utilizes Nck2 to activate Cdc42 and regulate cell polarization during cell migration in response to wound healing docx

... GGCUGUAUGUAGU-3¢; CrkL 5¢-CUUACUAGAUCCG UGAGUUAA-3¢; CrkII 5¢-GGAUCAACAGAAUCCCGA UTT-3¢; Control (designed to target luciferase) 5¢- CUUA CGCUGAGUACUUCGATT-3¢ Twenty nanomoles of siRNA was transfected ... v-Crk and v-Src in a tyrosine phosphorylation-dependent manner EMBO J 13, 3748–3756 Sakai R, Iwamatsu A, Hirano N, Ogawa S, Tanaka T, Nishida J, Yazaki Y & Hirai H (1994) Characterization, partial ... T, Nakamura K, Nakao K, Ishikawa T et al (1998) Cardiovascular anomaly, impaired actin bundling and resistance to Src-induced transformation in mice lacking p130Cas Nat Genet 19, 361–365 Honda...

Ngày tải lên: 23/03/2014, 03:20

12 355 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains...

Ngày tải lên: 23/03/2014, 07:20

11 427 0
Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx

Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx

... hylans for the treatment of osteoarthritis: mechanisms of action Arthritis Res Ther 2003, 5:54-67 23 Nagaya H, Yamagata T, Yamagata S, Iyoda K, Ito H, Hasegawa Y, Iwata H: Examination of synovial ... Nakajima T, Kitajima I, Shigeta K, Abeyama K, Imamura T, Okano T, Kawahara K, Nakamura T, Maruyama I: Thrombin receptor-mediated synovial proliferation in patients with rheumatoid arthritis Clin ... Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.: Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are associated with rheumatoid arthritis Nat...

Ngày tải lên: 09/08/2014, 06:22

6 437 0
Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx

Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx

... Cite this article as: Bhagawati-Prasad et al.: CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis Journal of Immune Based Therapies and Vaccines ... Chakrapani A, O’Hagan D: Nanoparticles and microparticles as vaccine-delivery systems Expert Rev Vaccines 2007, 6:797-808 Hatzifoti C, Bacon A, Marriott H, Laing P, Heath AW: Liposomal coentrapment ... authors have read and approved the final manuscript Competing interests AH is a Director of Adjuvantix Ltd and also holds some stock in Adjuvantix Adjuvantix Ltd have an interest in CD40mAb based...

Ngày tải lên: 11/08/2014, 08:21

3 245 0
báo cáo khoa học: " The acceptability and feasibility of peer worker support role in community based HCV treatment for injecting drug users" pot

báo cáo khoa học: " The acceptability and feasibility of peer worker support role in community based HCV treatment for injecting drug users" pot

... include broader medical, social and psychological issues such as acute situational crisis, depression, hypomania, anaemia, neutropenia, and a variety of substance use issues As such, sufficient and ... same treating doctors and nurses and building relationships was viewed as a key advantage of HCL Having the HLC embedded within a specialist alcohol and drug treatment centre was also viewed as ... potential clients and other substance use agencies about a broad range of clinical and logistical considerations relating to HCV treatment She talked about the importance of offering practical support,...

Ngày tải lên: 11/08/2014, 18:20

9 304 0
Báo cáo y học: "Noninvasive mechanical ventilation may be useful in treating patients who fail weaning from invasive mechanical ventilation: a randomized clinical trial" pps

Báo cáo y học: "Noninvasive mechanical ventilation may be useful in treating patients who fail weaning from invasive mechanical ventilation: a randomized clinical trial" pps

... IMV by analyzing cardiac and respiratory parameters, clinical course, and complications Page of (page number not for citation purposes) Materials and methods Population and sample A randomized ... clinically and radiographically by dyspnea with rales, S3, cardiomegaly, bilateral pulmonary edema, and elevated central venous pressure [27] Tracheotomy was performed between 14 and 21 days after ... to avoid placement of an invasive airway and to reduce complications and mortality due to IMV [2,28,29] However, few randomized clinical trials evaluated early use of NPPV to accelerate mechani-...

Ngày tải lên: 13/08/2014, 10:20

8 233 0
Báo cáo y học: "Combining multicriteria decision analysis, ethics and health technology assessment: applying the EVIDEM decisionmaking framework to growth hormone for Turner syndrome patients" ppt

Báo cáo y học: "Combining multicriteria decision analysis, ethics and health technology assessment: applying the EVIDEM decisionmaking framework to growth hormone for Turner syndrome patients" ppt

... collection and drafting of the manuscript JPG and CD reviewed and validated synthesized data All authors read and approved the final manuscript Competing interests The authors declare that they have ... consider in making healthcare choices, and transparent access to available data on which these considerations are based This approach is envisioned to help identify the issues at play and increase legitimacy ... combining efficient HTA, pragmatic MCDA, and an ethical framework to ensure systematic consideration of all components of decisionmaking and evidence available, and to provide a transparent record of...

Ngày tải lên: 13/08/2014, 11:22

15 326 0
Báo cáo y học: "Advances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clinical models: relevance for human health and disease" potx

Báo cáo y học: "Advances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clinical models: relevance for human health and disease" potx

... carcinogenesis by PPARgamma Proc Natl Acad Sci U S A 2002, 99:13771-13776 134 Yoshizawa K, Cioca DP, Kawa S, Tanaka E and Kiyosawa K Peroxisome proliferator-activated receptor gamma ligand troglitazone induces ... Y, Higuchi K, Arakawa T, Yano Y, Hasuma T and Otani S PPAR-gamma ligands inhibit growth of human esophageal adenocarcinoma cells through induction of apoptosis, cell cycle arrest and reduction ... troglitazone, an activator of the PPARgamma receptor, in patients with chemotherapy-resistant metastatic colorectal cancer Cancer J 2002, 8:395-399 165 Yamamoto Y, Nakajima M, Yamazaki H and Yokoi...

Ngày tải lên: 13/08/2014, 13:20

15 437 0
Báo cáo y học: " A mechanistic model of infection: why duration and intensity of contacts should be included in models of disease spread" ppt

Báo cáo y học: " A mechanistic model of infection: why duration and intensity of contacts should be included in models of disease spread" ppt

... secondary cases SC and the number of contacts S by calculating SC for the 720 person days as separate units of observation SC is calculated according to Equations and and based on the contact durations ... disease spread and combining them with an a posteriori, statistical approach: Often data is available that allows fitting a simulation model that includes such mechanistic elements to empirical ... this paper 12 Additional material Additional file Contact Data This additional file contains the processed empirical contact data that was used for calculating the results presented in this paper...

Ngày tải lên: 13/08/2014, 16:20

10 346 0
PURIFICATION OF SIMPL ANTIBODY AND IMMUNOFLUORESCENCE OF SIMPL SUB-CELLULAR LOCALIZATION IN RESPONSE TO TNFα- AND IL-1

PURIFICATION OF SIMPL ANTIBODY AND IMMUNOFLUORESCENCE OF SIMPL SUB-CELLULAR LOCALIZATION IN RESPONSE TO TNFα- AND IL-1

... cycling, and it is known to have an impact on cell adhesion and cell migration (Cardoso and Oliveira 2003; Pham et al 2003; Takeuchi and Baichwal 1995) Aberrations in its activation have been ... lymphocyte maturation, survival, activation, and clonal expansion (Gerondakis and Siebenlist 2010) B Inflammation Acute inflammation arises in tissues and organs in response to threats to the organism ... measured by UV absorbance with the exception of the first two antibody purifications (086B and 087B) which were measured via Bradford assay Bradford assay Bovine serum albumin (BSA) standards and...

Ngày tải lên: 24/08/2014, 12:43

63 162 0
a study on teachers and students attitudes towards the cultural content in the international commercial textbook for non english majors at haiphong private university

a study on teachers and students attitudes towards the cultural content in the international commercial textbook for non english majors at haiphong private university

... associated and teaching and learning a foreign language means teaching and learning the culture of the people whose mother tongue is the language being taught and learnt, the teaching and learning ... attitudes dramatically influence learning and teaching According to Gardner (1985),having a positive attitude toward the language and culture and toward learning a foreign language is an important contributor ... social space and history, and a common system of standards for perceiving, believing, evaluating, and action” (p.127) Because culture is embodied in language, language and culture are not fundamentally...

Ngày tải lên: 25/12/2015, 17:18

79 669 3
Báo cáo hóa học: " Research Article Meta-Model and UML Profile for Requirements Management of Software and Embedded Systems" pot

Báo cáo hóa học: " Research Article Meta-Model and UML Profile for Requirements Management of Software and Embedded Systems" pot

... common features, or common implementation platform Product variant is a parallel development path or customization of a product For instance, a color camera and black -and- white camera can be tailored ... such as Java Our requirements management meta-model can be, and has been, implemented as a spreadsheet template in Microsoft Excel application The benefit of UML profiling is the fast and easy transformation ... on SHAring and Reusing Architectural Knowledge Architecture, Rationale, and Design Intent, May 2007 [22] J Pardillo, F Molina, C Cachero, and A Toval, A UML profile for modelling measurable requirements,”...

Ngày tải lên: 21/06/2014, 05:20

14 438 1
Research Issues in Systems Analysis and Design, Databases and Software Development doc

Research Issues in Systems Analysis and Design, Databases and Software Development doc

... equivalence and emphasizes its use for the purpose of validating a detailed application model against an abstract domain model in the context of a domain analysis approach called application-based ... 1996) Way of Working In the first case, the way of working was adopted as early as 1990, and it has evolved and streamlined gradually and systematically There is a great resemblance between XP and ... requirements can often be seen as dynamic and changing rather than static and set According to Turk, France, and Rumpe (2004), XP’s values, activities, and practices are quite interrelated, with a relationship...

Ngày tải lên: 27/06/2014, 06:20

296 417 0
w