a disease that is often ignored f

Tài liệu Molecular Neurobiology of Alzheimer Disease and Related Disorders doc

Tài liệu Molecular Neurobiology of Alzheimer Disease and Related Disorders doc

... Takashi Kudo, Toshihisa Tanaka, Katsuhiko Yanagisawa, Akihiko Takashima, Takeshi Ishihara, Takeshi Tabira, Akihiko Nunomura, Tetsuaki Arai (Third row) Yoshitaka Tatebayashi, Taiichi Katayama, ... katayama@anat2.med.osaka-u.ac.jp Katayama/Manabe/Imaizumi/Sato/Hitomi/Kudo/Yanagita/Matsuzaki/ Mayeda/Tohyama 30 Takeda M, Tanaka T, Cacabelos R (eds): Molecular Neurobiology of Alzheimer Disease and Related Disorders ... Katayama/Manabe/Imaizumi/Sato/Hitomi/Kudo/Yanagita/Matsuzaki/ Mayeda/Tohyama 28 the absence of any mutations We demonstrated that HMGA 1a is a key factor that binds to PS2 pre-mRNA and causes its aberrant splicing that may be an initial...

Ngày tải lên: 14/02/2014, 17:20

312 470 1
Báo cáo khoa học: "Upregulated but insufficient generation of activated protein C is associated with development of multiorgan failure in severe acute pancreatitis" pot

Báo cáo khoa học: "Upregulated but insufficient generation of activated protein C is associated with development of multiorgan failure in severe acute pancreatitis" pot

... to organ dysfunction and permanent damage The interactions between coagulation and inflammatory pathways are essential in the pathogenesis of disseminated intravascular coagulation For example, ... plasma pool) were a frequent finding; found in 43% of all samples (68% of all patients) at various stages of the disease (Figure 1a) The intrapatient variation in PC levels from day to day was ... tomography was performed on all patients Organ failure was defined as the development of respiratory failure necessitating mechanical ventilation and/or renal failure necessitating haemodialysis...

Ngày tải lên: 12/08/2014, 23:21

9 294 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

... 3FLAG-tagged APP-CTFs mimicking products from cleavage at position 40 (gamma-3FLAG standard) and 49 (epsilon-3FLAG standard) were also made to aid in the identification of 3FLAG-tagged CTFs (Fig ... N-terminal fragment (NTF) Fractions were analysed for the presence of C101-3FLAG and PS1 NTF and the signals quantified by image densitometry (Fig 4A) A broad peak of C101-3FLAG immunoreactivity was found ... 5¢-GGGGGGCCAT GGCGACAGTGATCGTC-3¢; reverse, 3FLAG HindIII creating the plasmid c-3FLAG standard Finally, the primer pairs forward, 5¢-GGGGGGCCATGGTGATGCTGA AGAAGAACAG-3¢ and reverse 3FLAG HindIII...

Ngày tải lên: 16/03/2014, 23:20

14 421 0
The effect of s1p lyase deficiency on the metabolism of the alzheimer’s related amyloid precursor protein

The effect of s1p lyase deficiency on the metabolism of the alzheimer’s related amyloid precursor protein

... Index Fig 300: Increase of intracellular Ca2+ affects the metabolism of APP-FL and APP-CTFs Fig 311: Selective release of lysosomal Ca2+affects the APP metabolism Fig 32: Analysis of PKC localization ... Abbreviations AB Antibody ACSF Artificial Cerebrospinal Fluid AD Alzheimer's Disease ADAM A Disintegrin And Metallo Proteinase AICD Amyloid Intracellular Domain Aph1 anterior pharynx defective APLP ... the family of a disintegrin and metallo proteinases”: ADAM9, ADAM10, ADAM17 and ADAM19 (Allinson et al, 2003) All ADAM-proteins are type I transmembrane proteins and require zinc as a co-factor...

Ngày tải lên: 25/11/2015, 15:23

133 414 0
Tài liệu Báo cáo khoa học: Animal models of amyloid-b-related pathologies in Alzheimer’s disease docx

Tài liệu Báo cáo khoa học: Animal models of amyloid-b-related pathologies in Alzheimer’s disease docx

... pathogenesis Familial forms of AD, with an autosomal dominant mode of inheritance, account for < 2% of all AD cases Onset is most often before 65 years of age, and the penetrance is nearly always complete ... genes have a modest impact on the pathogenesis The major risk factors for AD are age and a family history of the disease Low education or cognitive reserve capacity, female gender, head trauma, hypertension, ... significantly to the understanding of molecular pathogenesis Today a wide range of animal models are available for mechanistic, therapeutic and functional studies They offer an appealing means to rapidly...

Ngày tải lên: 16/02/2014, 09:20

21 560 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer ... containing m urea, and the sample was eluted with a gradient of 0–300 mm NaCl in buffer A containing m urea Mass spectrometry, amino acid analysis and sequencing Amino acid analysis was performed...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

... gift from G E O Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer (5¢-GCTCTAGAGCTTCAC GGATGCATTATCGATGGGCTC-3¢) ... pSP64TK- EGFP (obtained from H Clarris, University of Melbourne, Parkville, Australia) with primer (5¢-TCAGGAGCTAA GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢) and primer (5¢-CCGCTCGAGTTACTTGTACAGCTCGT CCATGCC-3¢) ... RNA PCR Core kit from Perkin Elmer (Roche) and primers 11 (5¢-CTAGCTAGCATGACAGA GTTACCTGCACC-3¢) and 12 (5¢-ATAGTTTAGCG GCCGCTAGATATAAAATTGATGGAATGC-3¢) were used to amplify presenilin DNA DNA...

Ngày tải lên: 08/03/2014, 08:20

12 471 0
Báo cáo khoa học: Amyloid-b protofibril levels correlate with spatial learning in Arctic Alzheimer’s disease transgenic mice docx

Báo cáo khoa học: Amyloid-b protofibril levels correlate with spatial learning in Arctic Alzheimer’s disease transgenic mice docx

... performed in the same way as for the mAb158 protofibril ELISA Statistical analysis The Morris water maze data were analyzed by three-way factorial ANOVA with genotype, age and time as categorical ... categorical factors After analyzing the effect of age on escape latencies with single variance analysis, age groups were pooled and escape latencies were analyzed with two-way ANOVA and later with Fisher’s ... USA) Custom-made macros were used to measure the stained area of interest as percentage of total tissue area Biochemical Ab analysis Cortical and cerebellar brain tissues from perfused animals...

Ngày tải lên: 23/03/2014, 06:20

12 300 0
Báo cáo khoa học: Amyloid–cholinesterase interactions Implications for Alzheimer’s disease pot

Báo cáo khoa học: Amyloid–cholinesterase interactions Implications for Alzheimer’s disease pot

... variant AbGlu22 fi Gln was not [13] Consistent with previous observations is the fact that the presence of different types of Ab peptide differentially affects acetylcholinesterase activity, as ... indicate that the Ab oligomers instead of the amyloid fibrils ad the real culprit of Alzheimer’s disease In this context preliminary data from our laboratory indicates that acetylcholinesterase ... synthesis, and biological evaluation of conformationally restricted rivastigmine analogues J Med Chem 47, 5945–5952 Belluti F, Rampa A, Piazzi L, Bisi A, Gobbi S, Bartolini M, Andrisano V, Cavalli A, ...

Ngày tải lên: 23/03/2014, 07:20

8 254 0
Báo cáo khoa học: High-resolution NMR studies of the zinc-binding site of the Alzheimer’s amyloid b-peptide pdf

Báo cáo khoa học: High-resolution NMR studies of the zinc-binding site of the Alzheimer’s amyloid b-peptide pdf

... Such an apparent dissociation constant was calculated for all individual resonances (Fig 3A) The apparent dissociation constant varies along the peptide chain, indicating that this is a generalized ... Zinc-induced Alzheimer’s Abeta1–40 aggregation is mediated by conformational factors J Biol Chem 272, 26464–26470 Yoshiike Y, Tanemura K, Murayama O, Akagi T, Murayama M, Sato S, Sun X, Tanaka N & Takashima ... measurement of translational diffusion coefficients: a practical method to account for nonlinear gradients J Magn Reson 148, 343–348 Supplementary material The following supplementary material is available...

Ngày tải lên: 23/03/2014, 10:20

14 355 0
Báo cáo khoa học: Shedding of the amyloid precursor protein-like protein APLP2 by disintegrin-metalloproteinases Retinoic acid-induced upregulation of substrate and proteinase ADAM10 during neuronal cell differentiation ppt

Báo cáo khoa học: Shedding of the amyloid precursor protein-like protein APLP2 by disintegrin-metalloproteinases Retinoic acid-induced upregulation of substrate and proteinase ADAM10 during neuronal cell differentiation ppt

... ADAM10_for 5¢-CTGGCCAACCTATTTG TGGAA-3¢, ADAM10_rev 5¢-GACCTTGACTTGGACTG CACTG-3¢; BACE_for 5¢-GTTATCATGGAGGGCTTC TACGTT-3¢, BACE_rev 5¢-GCTGCCGTCCTGAACTCA TC-3¢; APLP2_for 5¢-CTCAGCGGATGATAATGAG ... S, Sorimachi H, Saido TC, Maruyama K, Okuyama A, Fujisawa-Sehara A, Ohno S, Suzuki K & Ishiura S (1999) Membrane-anchored metalloprotease MDC9 has an alpha-secretase activity responsible for processing ... 9B) Discussion We report the cleavage of the mammalian APP-related protein APLP2 by the disintegrin and metalloproteinases ADAM10 and TACE (ADAM17), and a common upregulation of ADAM10 and its...

Ngày tải lên: 30/03/2014, 11:20

13 288 0
báo cáo hóa học: " Inflammatory cytokine levels correlate with amyloid load in transgenic mouse models of Alzheimer''''s disease" potx

báo cáo hóa học: " Inflammatory cytokine levels correlate with amyloid load in transgenic mouse models of Alzheimer''''s disease" potx

... manufacturers protocol Statistical analyses For statistical analyses, ANOVA and t-tests were performed where appropriate using SPSS for Windows release 10.1 Hierarchical cluster analysis of A -cytokine ... agreement with a pro-inflammatory effect of A [25-29] A recent report has also shown increases in IL1β, IL-6 and TNFα in-vivo after intra-cerebral administration of fibrillar A into rat brain ... receptor antagonist (IL1ra)) IL-1α and IL-1β are two different isoforms of IL-1 that have similar affinities for their receptor IL-1R, and therefore have similar activities Both are capable of inducing...

Ngày tải lên: 19/06/2014, 22:20

10 689 0
báo cáo hóa học: " Toll-like receptor 2 -196 to -174 del polymorphism influences the susceptibility of Han Chinese people to Alzheimer’s disease" potx

báo cáo hóa học: " Toll-like receptor 2 -196 to -174 del polymorphism influences the susceptibility of Han Chinese people to Alzheimer’s disease" potx

... for sex and age (189 female and 211 male; mean age = 81.4 ± 5.4 years) All participants originated from Northern Han Chinese populations A clinical diagnosis of probable AD was established according ... criteria of National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer’s disease and Related Disorders Association (NINCDS-ADRDA) [14] All AD cases were defined as ... reported that CD14, TLR4, and TLR2 are necessary for binding fibrillar Ab (fAb) to the cell surface, and are required for phenotypic activation of microglia and induction of phagocytosis [5] Richard...

Ngày tải lên: 19/06/2014, 22:20

4 297 0
Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc

Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc

... The main risk factor for AD is increased age: as people age, the frequency of AD increases It is estimated that about 10% of people over 65 years of age and 50% of those over 85 suffer from AD ... steroidal alkaloids from Sarcococca saligna Helvetica Chimica Acta 2004, 87:439-448 17 Atta-ur-Rahman , Feroz F, Naeem I, Zaheer-ul-Haq , Nawaz SA, Khan Naeema, Khan MR, Choudhary MI: New pregnane-type ... causes a conformational change that defines a larger space in the deepest area of the cleft of BChE to allow the fitting of diverse BChEIs The availability of BChE to catalyze diverse substrates...

Ngày tải lên: 13/08/2014, 16:20

26 279 0
Tài liệu Alzheimer’s Disease and Other Dementias doc

Tài liệu Alzheimer’s Disease and Other Dementias doc

... complications of the disease Nancy Reagan has continued his work as a forceful advocate for the sake of Figure 1.6 President Ronald Reagan those who suffer from this © AP Images devastating disease ... functioning are the hallmark Dementia is not one specific disease Instead, dementia is a descriptive term for a collection of symptoms that can be caused by a number of different diseases or traumas that ... head trauma Dementia can also be caused by infections to the brain and hereditary diseases like Wilson’s disease Huntington’s disease is an involuntary movement disorder that is often associated...

Ngày tải lên: 14/02/2014, 18:20

129 594 0
Memory performance in healthy elderly without Alzheimer’s disease: effects of time and apolipoprotein-E pptx

Memory performance in healthy elderly without Alzheimer’s disease: effects of time and apolipoprotein-E pptx

... follow-up interval indicating that there was a normal distribution of performance and that the lack of an APOE-␧4 allele*time effect was not the result of a ceiling or floor effect Analyses stratified by ... Lehtovirta M, Laakso MP, Soininen H, Helisalmi S, Mannermaa A, Helkala EL, Partanen K, Ryynanen M, Vainio P, Hartikainen P, et al 1995 Volumes of hippocampus, amygdala and frontal lobe in Alzheimer patients ... and both age and education as independent variables The use of generalized estimated equations to evaluate the longitudinal data set is an added technical advantage because this statistical method...

Ngày tải lên: 05/03/2014, 21:20

7 474 0
LifeOut of Focus Alzheimer’s Disease and Related Disorders ppt

LifeOut of Focus Alzheimer’s Disease and Related Disorders ppt

... Yet here was a woman who was not yet in her declining years, suffering from this same problem WHAT IS DEMENTIA? Alzheimer’s disease is a form of senile dementia, a brain disease that affects the ... costing an average of $12,500 per year Most of this is paid for by the victim’s family • Half of all nursing home patients suffer from Alzheimer’s disease or a related disorder The average annual cost ... understandable that a few decades ago—when the population’s average age was significantly lower—Alzheimer’s wasn’t recognized as a major health and “quality of life” problem, as it is now At that...

Ngày tải lên: 05/03/2014, 23:20

105 461 0
PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx

PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx

... Diagnostic and Statistical Manual of Mental Disorders, 4th ed Washington, DC: APA, 1994 Rasmusson DX, Brandt J, Steele C, et al Accuracy of clinical diagnosis of Alzheimer disease and clinical features ... illustrates an approach toward scan interpretation that integrates the visual and quantifying information present in clinical PET scans Visual Assessment Systematic visual examination of a clinical brain ... Social, Educational, and Occupational Histories Assessing educational attainment and performance and occupational history provides additional information about a patient’s pre-evaluation level of...

Ngày tải lên: 05/03/2014, 23:20

231 535 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... Beal MF (1994) Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease Ann Neurol 36, 747–751 Modulation of metal availability for treating AD 81 Maynard CJ, Cappai R, Volitakis ... compilation ª 2007 FEBS 3779 Modulation of metal availability for treating AD P J Crouch et al established, but the role for metal dyshomeostasis in all aspects is clear In the AD affected brain, ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...

Ngày tải lên: 07/03/2014, 10:20

9 634 0
Báo cáo khoa học: Therapeutic approaches for prion and Alzheimer’s diseases pot

Báo cáo khoa học: Therapeutic approaches for prion and Alzheimer’s diseases pot

... prions A few cases of BSE have also been reported in other parts of the world, such as Japan, the USA and Canada Of greater concern in North America is chronic wasting disease (CWD) This disease is ... human and veterinary medicine [135] A main advantage for this system is that the safety of human administration of live attenuated Salmonella has been extensively confirmed in humans and animals ... PrPSc Vaccination approaches for AD Vaccination was the first treatment approach demonstrated to have genuine impact on disease process, at least in animal models of AD Vaccination of AD transgenic...

Ngày tải lên: 07/03/2014, 10:20

15 582 0
w