a disease of specific dysregulation
Báo cáo khoa học: " Bench-to-bedside review: Sepsis is a disease of the microcirculation" pps
Ngày tải lên :
12/08/2014, 20:20
... many of the manifestations of septic shock such as vasoplegia, diminished myocardial contractility, hepatic damage, and vascular and intestinal hyperpermeability Others, however, found decreased ... [8], an increased percentage of activated neutrophils with decreased deformability and increased aggregability due to the upregulation of adhesion molecules [9], activation of the clotting cascade ... Perfusion of the microcirculation is regulated by an intricate interplay of many neuroendocrine, paracrine, and mechanosensory pathways [7] These mechanisms adapt to the balance between locoregional...
- 7
- 240
- 0
báo cáo hóa học: " Comparing a disease-specific and a generic health-related quality of life instrument in subjects with asthma from the general population" pot
Ngày tải lên :
18/06/2014, 22:20
... 10 Validation measures We used a number of validation measures available from the SAPALDIA database that met the Global Initiative for Asthma criteria for the assessment of asthma [17] Data from ... Federal Office for Forest, Environment and Landscape, the Federal Office of Public Health, the Federal Office of Roads and Transport, the canton's government of Aargau, Basel-Stadt, Basel-Land, ... statistical analysis and revised the manuscript All authors read and approved the final manuscript Acknowledgements 10 SAPALDIA Team (Swiss cohort study on air pollution and respiratory disease...
- 11
- 767
- 0
báo cáo hóa học:" Application of a disease-specific mapping function to estimate utility gains with effective treatment of schizophrenia" pot
Ngày tải lên :
20/06/2014, 15:20
... appears to have greater precision than a SF-36-based mapping function One of the greatest advantages of the diseasespecific mapping function is that it uses data generally available in clinical ... health states are based on a combination of clinical data and expert judgment We believe that this is an optimal mix because it is a datadriven approach that compensates for under-representation ... anticholinergic agents, antidepressants, mood stabilizers, propranolol for akathisia, and benzodiazepines for agitation and insomnia Assessments PANSS total scores [15] and health-related quality -of- life assessments,...
- 8
- 374
- 0
Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx
Ngày tải lên :
09/08/2014, 14:22
... relating to sociodemographic data, disease- related variables and the quality of life The sociodemographic variables were age, gender, education, marital status, and the duration of FM symptoms Age ... sensitivity) and false-positive ratios (or 1-specificity) of a particular cut-off value, and may help in selecting the optimal cut-off value for a new scale: i.e assuming an optimal FAS cut-off value of ... the average values Bland and Altman Status values plotted against differences in Fibromyalgia Assessment Status values plotted against average values Ninetyfive percent of the differences against...
- 12
- 423
- 0
Báo cáo y học: "Tibialis posterior in health and disease: a review of structure and function with specific reference to electromyographic studies" pot
Ngày tải lên :
10/08/2014, 21:23
... medial malleolus (M) and tendo Achilles (TA) Small arrow indicates rounded TP tendon proximally and large arrow indicates the flattened area of tendon in retromalleolar region as a result of the ... Journal of Foot and Ankle Research 2009, 2:24 Figure Audit of placement of intramuscular electrode Audit of placement of intramuscular electrode Gross anatomy of dissected limb with intramuscular ... JW and DET critically revised the manuscript All authors read and approved the final manuscript Additional material Additional file Posterior approach A video demonstration of the posterior approach...
- 8
- 530
- 0
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
Ngày tải lên :
03/11/2012, 11:52
... Renal Data System USRDS 2003 annual data report: atlas of end-stage renal disease in the United States Bethesda: National Institutes of Health, National Institute of Diabetes and Digestive and Kidney ... glomerular filtration rate from serum creatinine J Am Soc Nephrol 2000; 11: 15 5A- 15 5A Sarnak MJ, Levey AS, Schoolweth AC, et al Kidney disease as a risk factor for development of cardiovascular disease: ... cardiovascular disease In addition, data on food intake, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a better...
- 5
- 723
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
Ngày tải lên :
28/03/2014, 20:20
... Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, J (2000) Parkinson’s disease and the art of moving Oakland, CA: New Harbinger Beauchet, ... 1989) Additionally, dance appears to be an appropriate and pleasurable therapeutic activity for the elderly, in terms of its benefits to physical, mental and emotional states (Kudlacek et al 1997) ... will fall at least once in the span of a year (Hornbrook et al 1994; Hausdorff et al 2001; CDC 2004) Falls can lead to fear of falling, reduced quality of life, withdrawal from activities, and injury...
- 19
- 648
- 0
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot
Ngày tải lên :
29/03/2014, 21:20
... ´ C J Almeciga-Dıaz et al Although bone marrow transplantation improves many aspects of the somatic manifestations, it has a limited impact on cardiac, eye and skeletal abnormalities, in addition ... vg of CMV– GALNS, AAT–GALNS or EF1–GALNS, and harvested 2, 4, and 10 days post-transduction All assays were carried out in duplicate Total DNA and RNA were isolated with the AllPrep DNA ⁄ RNA ... calcium phosphate-mediated cotransfection of pAAV–CMV–GALNS, pAAV– AAT–GALNS or pAAV–CMV–SUMF1 with pXX2 and pXX6-80 (Gene Therapy Center, University of North Carolina at Chapell Hill, NC, USA)...
- 12
- 460
- 0
anthracnose. a fungal disease of shade trees
Ngày tải lên :
20/04/2014, 16:13
... margin • On ash, large, irregular, light brown spots appear, most often along leaf margins (Fig 4) • On linden, large brown areas with black margins appear, especially Fig Leaf symptoms of anthracnose ... anthracnose on sugar maple along main leaf (Photo by M A Hansen) veins The areas are small to large and circular to elongate • On birch, small, irregular, circular, brown spots with dark brown margins ... margins Fig Anthracnose on ash (Photo by Virginia Tech Photo Lab) are apparent • On hickory, large, irregular, reddish brown spots appear on the upper leaf surface and a dull brown area is apparent...
- 2
- 107
- 2
báo cáo hóa học: " A review of health utilities using the EQ-5D in studies of cardiovascular disease" potx
Ngày tải lên :
18/06/2014, 19:20
... failure; AMI: Acute myocardial infarction; Amp.: Amputation; Angio: Coronary Angiography; ASA: American Society of Anaesthesiologists; ASCOT-AHD: Anglo-Scandinavian cardiac outcomes trial - anti-hypertensive ... Tables/Figures AAA: Abdominal aortic aneurysm; ACS: Acute coronary syndromes; ACT: Anticoagulation therapy; AF: Atrial fibrillation; AH-Drug: Anti-hypertensive drug therapy; AHF: Advanced heart ... scores and disease severity in terms of either CCS Angina class or NYHA heart failure class at baseline Fixed and random effects meta-analyses of heart failure patients stratified by NYHA class and...
- 12
- 656
- 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
Ngày tải lên :
18/06/2014, 22:20
... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... CCAAGCTGTGTCCTRTCC TGTTGACAGYCVTT CCKGGT TAYTTTAAAARGTGTCMAGTGT CTYTTAAAAGGKGTCCAGWG CYTTTAMATGGTATCCAGTGT ATGGCAGCWGCYCAAAG CTTTTAAAAGWTGTCCAGKGT CTTCCTGATGGCAGTGGTT TAACCCTTGACCAGGCATCC Key to degenerate nucleotides: ... TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG AGGTVVAGCTGCAGVAGTCWGG ACTGCAGGTRTCCACTCC RCTACAGGTGTCCACTCC GCYACAGMTGTCCACTCC ACTGCAGGTGTCCTCTCT RCTRCAGGYGTCCACTCT CCAAGCTGTGTCCTRTCC...
- 10
- 541
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên :
19/06/2014, 22:20
... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and ... isoprenylation of Rac is critical for Rac's subcellular localization, interactions with RhoGDI, anchoring to the plasma membrane and ultimately to the activation of inflammatory signaling pathways [114]...
- 12
- 413
- 0
báo cáo hóa học: " ELISA measurement of specific non-antigenbound antibodies to Ab1-42 monomer and soluble oligomers in sera from Alzheimer’s disease, mild cognitively impaired, and noncognitively impaired subjects" pptx
Ngày tải lên :
19/06/2014, 22:20
... W, Kawarabayashi T, Matsubara E, Deguchi K, Murakami T, Harigaya Y, Ikeda M, Amari M, Kuwano R, Abe K, Shoji M: Plasma antibodies to Abeta40 and Abeta42 in patients with Alzheimer’s disease and ... Markesbery WR, Mattson MP: Autoantibodies to amyloid beta-peptide (Abeta) are increased in Alzheimer’s disease patients and Abeta antibodies can enhance Abeta neurotoxicity: implications for disease ... measures ANOVA The standard deviation of concentration and the mean concentration of anti-Ab antibodies in NCI sera (averaged between dissociated and undissociated samples) were estimated from the data...
- 11
- 410
- 0
Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx
Ngày tải lên :
20/06/2014, 00:20
... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... The AgNOR analysis was performed by counting the number of AgNOR (black dots) per cell at a magnification of 1000× (each group n = animals) Analysis of data The secretory basal and stimulated activity ... does not automatically lead to an improvement of clinical symptoms in airway diseases such as allergic asthma [66], other features of airway diseases such as hypersecretion or cough are currently...
- 10
- 568
- 0
báo cáo hóa học: " A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel" doc
Ngày tải lên :
20/06/2014, 00:20
... of occupational stress in urban EMT-paramedics [see comment] Ann Emerg Med 1989, 18:1151-1156 Mahony KL: Management and the creation of occupational stressors in an Australian and a UK ambulance ... administrative-organizational stressors may not be an expected part of ambulance work and a high frequency level may over time be an important source of frustration and low job satisfaction among ambulance ... among ambulance personnel are mainly related to ambulance specific stressors • Health complaints and low job satisfaction among ambulance personnel are mainly related to general job-related stressors...
- 9
- 531
- 0
Báo cáo hóa học: " Sargassum fusiforme fraction is a potent and specific inhibitor of HIV-1 fusion and reverse transcriptase" pot
Ngày tải lên :
20/06/2014, 01:20
... microglia, and astrocytes by Sargassum fusiforme AIDS Res Ther 2006, 3:15 Hoshino T, Hayashi T, Hayashi K, Hamada J, Lee JB, Sankawa U: An antivirally active sulfated polysaccharide from Sargassum ... NCI-Frederick), and was also quantified for titers of infectious virus by multinuclear activation of a β-galactosidase indicator (MAGI) assay [20] Culture supernatants contained to µg of viral p24 protein ... CCF2/AM dye and fusion was analyzed by multiparameter flow cytometry using a violet laser for excitation of CCF, and gated from 10,000 cells Percentages in each panel are of cells displaying...
- 9
- 438
- 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf
Ngày tải lên :
20/06/2014, 04:20
... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... CCAAGCTGTGTCCTRTCC TGTTGACAGYCVTT CCKGGT TAYTTTAAAARGTGTCMAGTGT CTYTTAAAAGGKGTCCAGWG CYTTTAMATGGTATCCAGTGT ATGGCAGCWGCYCAAAG CTTTTAAAAGWTGTCCAGKGT CTTCCTGATGGCAGTGGTT TAACCCTTGACCAGGCATCC Key to degenerate nucleotides: ... TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG AGGTVVAGCTGCAGVAGTCWGG ACTGCAGGTRTCCACTCC RCTACAGGTGTCCACTCC GCYACAGMTGTCCACTCC ACTGCAGGTGTCCTCTCT RCTRCAGGYGTCCACTCT CCAAGCTGTGTCCTRTCC...
- 10
- 401
- 0
báo cáo hóa học:" Revision hip replacement for recurrent Hydatid disease of the pelvis: a case report and review of the literature" doc
Ngày tải lên :
20/06/2014, 04:20
... with Praziquental and Albendazole and she was discharged home on Albendazole Histology again confirmed the diagnosis of hydatid disease She was reviewed in the clinic on 6/6/00 and had an MRI ... Hydatid disease can be difficult especially in countries where the disease is extremely rare Bony hydatid disease is rare even in endemic areas Symptoms and signs are often mistaken for bacterial ... Muhtaseb SA, el-Beltagi A, Badr S, elSaghir E: The imaging appearances of hydatid disease at some unusual sites Br J Radiol 2001, 74:283-289 Duncan GJ, Tooke SM: Echinococcus infestation of the...
- 5
- 476
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
Ngày tải lên :
20/06/2014, 04:20
... this article as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic ... Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's disease of bone in Japan J Bone Miner Metab 2006, 24:186-190 Takata S, Hashimoto J, Nakatsuka K, Yoshimura ... Yabe H, Abe S, Fukunaga M, Terada M, et al.: Guidelines for diagnosis and management of Paget's disease of bone in Japan J Bone Miner Metab 2006, 24:359-367 Kanis JA: Pathophysiology and treatment...
- 4
- 402
- 0
Báo cáo khoa học: " Use of flow cytometry to develop and characterize a set of monoclonal antibodies specific for rabbit leukocyte differentiation molecules" ppsx
Ngày tải lên :
07/08/2014, 20:23
... BAQ4 4A CADO3 4A RACT4 8A HUH7 3A RTH16 1A RT1 8A RT 3A MRB12 8A CAM3 6A H2 0A HUH8 2A BAQ3 0A BAG4 0A LT4 1A ISC1 8A ISC3 9A ISC7 6A ISC 4A ISC2 4A ISC2 6A ISC3 6A ISC9 0A RT1 5A RTH3 3A RACT4 3A RACT4 4A RACT3 8A RT2 3A ... RTH 2A RTH23 0A RTH2 1A RT2 2A MRB6 1A RTH2 6A RTH6 5A RACT5 3A RTH 1A RTH19 2A ISC1 6A ISC2 7A ISC29E ISC3 8A RT 1A RACT1 9A RACT2 0A MRB12 0A RACT1 4A RACT2 1A RACT3 0A MRB2 5A MRB2 9A MRB14 3A BAQ4 4A CADO3 4A RT1 9A ... blood and primary and secondary lymphoid organs mAb H 1A H5 8A TH14B TH8 1A5 RTH 2A RTH23 0A RTH2 1A RT2 2A MRB6 1A RTH2 6A RTH6 5A RACT5 3A RTH 1A RTH19 2A ISC1 6A ISC2 7A ISC29E ISC3 8A RT 1A RACT1 9A RACT2 0A MRB120A...
- 16
- 365
- 0