a different kind of change
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt
... D47 No (mm) Standard Distance Sr/Ca d13CPDB d18OPDB error (mm) A3 6 A3 5 A3 3 A3 2 A3 1 A2 9 A2 8 A2 7 A2 6 A2 5 A2 4 A2 3 A2 2 A2 1 A1 9 A1 8 A1 7 A1 6 A1 5 A1 4 A1 3 A1 2 A1 0 A9 A8 A7 A6 A5 A4 A2 0.03 0.03 0.03 ... plots all analyses of the NBS-19, MAR-J1, MZ carbonate and Sigma-carb standards made between January, 2004 and April, 2005 Each data point represents the average of between and 10 analyses of the ... temperature of calcite precipitation and the D47 value carbon dioxide extracted from that calcite A least-square Average Standard error Calcite HA2 23 ± À7.54 Average Standard error Calcite HA7 Average...
Ngày tải lên: 22/03/2014, 18:20
A Different Story of the History of Western Music and the Aesthetic Project pdf
... Haydn sonata can a lot But in this type of music always lies a great deal that is vague, ambiguous, uncertain, and you have to have a certain amount of training to get true pleasure from it (as ... the Age of Enlightenment, then, we witness the renaissance of the word ‘aesthetics’ We find that there was a gradual change in the nobleman’s ways of looking at art and of thinking and acting and ... characterized by a hegemony of surface aesthetics where the prevalence of an “always-acting” aesthetic results in the “always-aesthetic experience” of aeV This has happened at the same time as...
Ngày tải lên: 23/03/2014, 13:20
backpacking a different way of camping
... car camping cannot The most beautiful sights are seen while backpacking, and this is because a car can only take one so far Most backpackers experience something that most car campers will ... most car campers will never see: the beauty of nature untouched by common man Regardless of the mode of exploring the great outdoors, an exciting adventure awaits ...
Ngày tải lên: 02/04/2014, 18:00
Báo cáo hóa học: " Research Article Automatic Threshold Determination for a Local Approach of Change Detection in Long-Term Signal Recordings" doc
... Comparison of DCS and MDCS methods by ROC curves computed from simulated data x-axis: false alarm probability, yaxis: detection probability for the classical CUSUM approach after parameter estimation ... Evolution of DCS before and after the change time (change not detected) (c) Evolution of MDCS before and after the change time (change detected) For all tracings, x-axis: number of points, y-axis: arbitrary ... previous paragraph Segmentation was achieved with successive values of kL and kH and the number of nondetection and false alarms counted Figure shows the variation of the segmentation error (sum of...
Ngày tải lên: 22/06/2014, 19:20
Stephen Wolfram - A New Kind Of Science Episode 12 doc
... output of my early cellular automata, 19 Linear algebra and CA invariances, 1022, 1023 and dimensions of networks, 1031 and models of memory, 1101 Linear cellular automata see also Additive cellular ... in nature, 1185 Karatsuba, Anatolii A (Russia, 1937- ) and multiplication, 1142 Kardar-Parisi-Zhang (KPZ) equation, 925 Kari, Jarkko J (Finland/USA, 1964- ) and undecidability in 2D cellular automata, ... cellular automata, 1023 of digits in rationals, 912 of finite-size CAs, 260 for linear congruential generators, 974 longest in cellular automata, 1088 maximal in CAs, 951 for mobile automata, 887 and...
Ngày tải lên: 12/08/2014, 08:20
Báo cáo lâm nghiệp: "Changes in air quality in different phases of forest management process in a sub-mountain beech ecosystem (West Carpathian Mts.)" pdf
... hand, pointing out the presence of climate change In the case of small areal units, passive sampling is a method well-fitted for evaluating the data in terms of potential damage to forest stands ... trends, we also evaluated temporal trends and input dynamics of the proton load Evaluating the annual means we can see (Fig 1) that the trend of proton load (H+) was increasing on all the studied ... pollution and climate change of forests of Tatra Mountains, Central Europe In: Omasa K., NOUCHI I., DE Kok L.J (eds), Plant Responses to Air Pollution and Global Change Tokyo, Springer-Verlag: 111–121...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo y học: "Reproducibility and sensitivity to change of various methods to measure joint space width in osteoarthritis of the hip: a double reading of three different radiographic views taken with a three-year interval" pot
... to the American College of Rheumatology criteria [20]), who were 45–75 years old and who had a manually measured JSW on plain AP pelvic radiograph of 1–4 mm at baseline All patients gave written ... number of sets of radiographs required in each stratum was 25 Radiographic techniques All radiographs were obtained at a standard size of 1/1 with the patient in a weight-bearing position The X-ray ... statistical analysis IK performed the follow-up of the trial and the radiographic study, and data management BM, TS and EV significantly contributed to devising the protocol, analysis of data and...
Ngày tải lên: 09/08/2014, 07:20
Tài liệu HOW TO HANDLE DIFFERENT TYPES OF RETAIL SHOPPERS AND MAKE SHOPPING A MEMORABLE EXPERIENCE FOR THEM pdf
... major advantage such customers offer to a sales person is „their inability to decide‟, a sales person can get a cue of such customer from the way they roam around the store with a weary or amazed ... humble and patient to listen to their knowledgeable views Therefore instead of you doing the talking, let them speak and as soon as you get a cue that they are aware about the product/brand and are ... like management, retailing is also an art as well as science While the scientific back support comes from the way a store is administered and its financial soundness whereas the art of retailing...
Ngày tải lên: 19/02/2014, 10:20
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf
... with Class I or normal cephalometric values Using Dolphin Imaging and Graphics ® lateral cephalograms of subjects in natural posture were scanned Lateral cephalogram and profile images of each subject ... generate another manipulated images In these created images, hard tissue normal values were altered in at least two standard deviations Facial profile images were digitally manipulated in the anterior-posterior ... growth of upper and lower jaw variations, as well as a bi-maxillary protrusive profile typical of Mexican subjects, and bi-maxillary retruded profile representing the typical straight profile in Caucasian...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx
... states of replication, and secondly the elaboration of a protocol for preparing a cell fraction that contains the cellular chromatin and specifically retains the functionally bound (replication) ... for 30 at 37 °C Cell culture, transient hypoxia, reoxygenation and radioactive labeling Cell fractionation T24 cells (gift from Altana Pharma, Konstanz, Germany) were grown in plastic flasks in ... the Materials and methods (A) Cells after medium renewal; (B) cells after medium renewal and h of hypoxia (200 p.p.m.); (C) the same cells after h of hypoxia (200 p.p.m) and h aerated incubation...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu The wisdom of coaching: Essential papers in consulting psychology for a world of change pot
... human behavior, and the psychodynamic aspects of organizational and managerial life and the lack of practical guidance for how consultants and coaches can and should work with executives and managers ... analyses of both qualitative and quantitative data Qualitative data indicated that both coaches and coachees had favorable reactions to the coaching process Two themes emerged from these data: ... PREPARE FOR A PRACTICE AS A PROFESSIONAL EXECUTIVE COACH Professional executive coaches are not born As described above, it is a specialty of organizational consultation that requires a complicated...
Ngày tải lên: 21/02/2014, 16:20
Báo cáo " Landscape ecological planning based on change analysis: A case study of mangrove restoration in Phu Long - Gia Luan area, Cat Ba Archipelago" pot
... Pteridaceae (Polypodiophyta), Acanthaceae, Asteraceae, Avicenniaceae, Combretaceae, Euphorbiaceae, Myrsinaceae, Rhizophoraceae, Sterculiaceae and Verbenaceae (Table 2) 138 N .A. Thinh et al. / VNU Journal of Science, Earth Sciences 24 (2008) 133‐144 ... Gia Luan commune Gia Luan commune C2 C2 Bai Giai C4 C4 Bai Giai C2 C2 C2 C2 a t a t a t a t a t a t a t ba t a Cat Cai Vieng marshland 2,303,001 Cai Vieng marshland C3 C3 C2 C2 Hai village a a ... aureum L Magnoliophyta Acanthaceae Acanthus ilicifolius L Asteraceae Pluchea indica (L.) Less Avicenniaceae Avicennia marina (Forsk) Vierh Combretaceae Lumnitzera racemora Willd c) Ecological succession...
Ngày tải lên: 14/03/2014, 15:20
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse) The pET151 HP1287 plasmid was amplified using PfuTurbo DNA polymerase and incubated with DpnI to digest the template plasmid Mutated ... QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...
Ngày tải lên: 16/03/2014, 00:20