a despopoulos et al thieme 2003 pdf

... and each term carries assumptions that can be grossly misleading DNA analysis can offer relevant data, but it cannot stand alone We need an updated version of ethnographic analogy that takes account ... technocultural revolution The age of genetics is also an era of what Abby Lippman calls geneticization (1991, 1992) and what Paul Rabinow (1996) calls biosociality Lippman’s geneticization describes a ... concerns in cultural anthropology with transnationalism and social movements (An example is Chaia Heller and Arturo Escobar’s essay, chapter in this volume.) A third arena was medical anthropology,...

Ngày tải lên: 08/04/2014, 12:36

... and each term carries assumptions that can be grossly misleading DNA analysis can offer relevant data, but it cannot stand alone We need an updated version of ethnographic analogy that takes account ... technocultural revolution The age of genetics is also an era of what Abby Lippman calls geneticization (1991, 1992) and what Paul Rabinow (1996) calls biosociality Lippman’s geneticization describes a ... concerns in cultural anthropology with transnationalism and social movements (An example is Chaia Heller and Arturo Escobar’s essay, chapter in this volume.) A third arena was medical anthropology,...

Ngày tải lên: 11/06/2014, 12:49

Ngày tải lên: 08/03/2014, 15:20

... questionnaire was presented as a visual analogue scale (VAS) Statistical Analysis We recorded the four biofeedback values (bilateral hip and knee joints) during all conditions for the swing-phase ... statistical analysis for the three baseline measurements in all subjects was calculated using repeated measures ANOVA Motor output parameters were analyzed using a × mixed ANOVA with GROUP (patient ... CP, tetraplegia (II) Abbreviations: CP = Cerebral Palsy; BS-CP = bilateral spastic cerebral palsy; MS = Multiple Sclerosis; SCI = Spinal cord injury Brütsch et al Journal of NeuroEngineering and...

Ngày tải lên: 19/06/2014, 08:20

... several approaches to evaluate the effects of incoming stimulus on cardiovascular systems Sugita et al show how to evaluate reproducibility and adaptation of visually induced motion sickness based ... Several time-scales in biosignals during exercise [11] tion factor and trigger factors [7] An accumulation factor has a long time scale because it relates to background ANA, while trigger factors ... different time-scales for studying cybersickness Virtual Reality, Human-Computer Interaction International 2007, LNCS 4563:262-9 Saito M, Tsukanaka A, Yanagihara D, Mano T: Muscle sympathetic nerve...

Ngày tải lên: 19/06/2014, 10:20

... verification patterns Data-in streams Data-out streams Parameter-in Parameter-out stream stream Test generator script Direct I/O data Memory image Interface specification Verification program Virtual ... dedicated parameter streams, para in and para out, for the input and output parameters, respectively Values in each stream are devided into blocks, for synchronization across streams As already explained, ... virtual prototyping of DSP SOCs using grammar based approach,” Design Automation for Embedded Systems, vol 5, no 3-4, pp 295–311, 2000 [7] C A Valderrama, A Changuel, and A A Jerraya, “Virtual...

Ngày tải lên: 22/06/2014, 23:20

... Creation 49 Ausma Viļumsone and Inga Dāboli a Chapter Human Visual Field and Navigational Strategies J Antonio Aznar-Casanova, Nelson Torro-Alves and José A da Silva Chapter Virtual Worlds as an ... data Noldus is ethnographic video analysis software which facilitates the collection, management, analysis and presentation of observational data It allows researchers to view video footage and ... statistically analysed using a repeated measures ANOVA parametric test to establish the differences between participants’ performance on the three tasks (traditional face-to-face design, virtual...

Ngày tải lên: 27/06/2014, 00:20

... and practices (KAP) of private medical practitioners, along with TB patients and pharmacists selling TB drugs in the Federal Capital of Pakistan and its neighboring city (i.e Islamabad and Rawalpindi) ... 1962-1964 25 10.Fanning EA Globalization of Tuberculosis Journal of Canadian Medical Association-Journal of Association Medicale Canadienne 1998; 158(5): 611-612 11.Volmink J, Matchaba P, Garner P Directly ... revised after pilot testing to accommodate a better range of responses Data entry and construction of analysis tables was done in Microsoft Excel Analysis of data was done by tallying data by identifying...

Ngày tải lên: 20/01/2016, 12:54

... Congenital Syphilis in Asia-Pacific 2011-2015 Focus countries are India, Indonesia, Myanmar, Nepal and Thailand Additional details are available on the Regional Office web site.7 5.   http://www.afro.who.int/en/clusters -a- programmes/dpc/acquired-immune-deficiency-syndrome.html, ... [all regions] •  uidance in diagnosis and management of major AIDS-associated cancers (cervical cancer, Kaposi G sarcoma and lymphomas) in adults and children and HIV-associated pneumonia and ... prequalified laboratories and quality monitoring of antiretroviral medicines in selected countries L [EMP] •  outine and maintenance analysis/data management of the pharmacovigilance database...

Ngày tải lên: 18/02/2014, 15:20

... planning asymmetry as a cause of movement lateralization Neuropsychologia 2004, 42(8):1041-1049 51 Ang K, et al: A clinical evaluation on the spatial patterns of non-invasive motor imagery-based brain-computer ... moving hand, as assessed by fMRI and PET [30-33] Additionally, ipsilateral activation is both found in M1 and shifted laterally, ventrally, and anteriorly towards PMC for unimanual tasks with ... [O2Hb] and [HHb] for drift elimination Data Analysis Descriptive analysis was calculated for all median signal amplitudes (μmol/l ± SD) Each source-detector combination (channel) and each condition...

Ngày tải lên: 19/06/2014, 08:20

... verbale a lungo termine Taratura su soggetti normali Arch Psicol Neurol Psichiatr 1986, 47:278-96 36 Orsini A, Grossi D, Capitani E, et al: Verbal and spatial immediate memory span: normative data ... 69,7 M: male; F: female Front: frontal; temp: temporal; hipp: hippocampal; thal: thalamus; temp-pariet: temporo-parietal +: preserved performance (above cut-off); -: impaired performance (under ... to evaluate right-left orientation ability, whereas geographical knowledge was measured by means of Italy Map test [34] Finally, the presence of unilateral spatial neglect was assessed by means...

Ngày tải lên: 19/06/2014, 08:20

... present an integrated evaluation method in which neuropsychological spatial ability evaluation is extended with more situational computer based tools that allow the assessment of spatial orientation ... papers and five short communications included in this issue span a wide range of clinical areas that can be impacted by virtual reality Several of these papers have demonstrated that a virtual ... Virtual reality has also been explored as a tool to assess disability Keshner, Streepey, Dhaher, and Hain used a virtual environment to measure the combined effect of visual and physical disturbances...

Ngày tải lên: 19/06/2014, 10:20

... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... and Technological Challenges," in National Research Council, National Academic Press, Washington, DC, 1995 R S Kalawsky, The Science of Virtual Reality and Virtual Environments, Addison-Wesley, ... PROTOTYPING/MANUFACTURING AND VR The terms virtual prototyping and virtual manufacturing are commonly used in academia and industry and can be easily confused with virtual reality (technology or applications)...

Ngày tải lên: 23/01/2014, 07:20

... virulence factors target small GTPases to limit bacterial uptake in order to prevent internalization and killing In addition, a different GTPase targeted by YpkA-mediated phosphorylation, Gaq, may also ... LSM510 Meta Confocal Imaging System, Jena, Germany) For the statistical analysis to determine the ratio between intracellular and extracellular bacteria the experiment was repeated three times and ... Gaq-mediated signalling pathways including RhoA activation and cytoskeletal rearrangements in the host cell [15] In addition, a crystallography-based study revealed that YpkA mimics host guanine nucleotide...

Ngày tải lên: 16/02/2014, 15:20

... two-dimensional analysis: identification of seven genes encoding new dockerin-containing proteins J Bacteriol 189, 2300– 2309 Maamar H, Abdou L, Boileau C, Valette O & Tardif C (2006) Transcriptional analysis ... mannanase from Bacillus circulans (accession no BAA25878.1) [31] Protein 7b was identified as the mannanase Man2 6A [14] Lastly, protein 13 was identified as an N-terminal dockerin-borne chagasin ... efficiency of plant cell-wall degradation processes Experimental procedures Bacterial strain and cell culture conditions C cellulolyticum ATCC35319 [41] was grown anaerobically at 32 °C on basal medium...

Ngày tải lên: 18/02/2014, 08:20

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... 0–300 mm NaCl in buffer A containing m urea Mass spectrometry, amino acid analysis and sequencing Amino acid analysis was performed at the Amino Acid Analysis Center, University of Uppsala, Sweden...

Ngày tải lên: 18/02/2014, 13:20

... ACCAGAAGACATTACAGTGAAAATTGA GGGAACCAGCAGTCGTCAAA CGTCCACTGAGAGGATGAGACA AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG CAATGAACAAAAAAGTCGCAACA GGGATGGAGGGTAAGACCATACA ACGGAGGTTGACGGGACTT GCTGGCACCACGATTGG ... AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT CGTCCGATTTCTTCTCGTGTTT ACCAGAAGACATTACAGTGAAAATTGA ... to 3’) MTA-1 AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA GATACAGCAAACGGAAAGTCAACA CAGTTCCTCGGGCCAACA GCCCCCCTCCCACACA CATCTTCGGCCGTCTTTCC GTTCTTGTTCCTGCTCATCAGTATG TGGATCGCCAAAAACTCATG AATGCTGGCTCTCCCTCGAT...

Ngày tải lên: 18/02/2014, 16:20

... Journal 275 (2008) 1274–1282 ª 2008 The Authors Journal compilation ª 2008 FEBS A Tanka-Salamon et al Fatty acids as plasmin inhibitors All three fatty acids examined caused a 10–20-fold increase ... all three fatty acids affected the activity of miniplasmin in the same manner as that of plasmin; apparent activation was seen with stearate and inhibition was seen with oleate and arachidonate ... parameters aj and bj FEBS Journal 275 (2008) 1274–1282 ª 2008 The Authors Journal compilation ª 2008 FEBS A Tanka-Salamon et al Fatty acids as plasmin inhibitors were estimated by the ordinary...

Ngày tải lên: 18/02/2014, 17:20

... AAM30557.1 AAM30558.1 CAC30667.1 AAK47445.1 CAD85942.1 CAD85943.1 AAQ66699.1 AAL64906.1 AAL63225.1 AAL64927.1 CAB49868.1 CAB49676.1 CAB49100.1 CAB49104.1 AAG28455.1 AAL80994.1 AAL81517.1 AAA72035.1 AAL80396.1 ... Microorganism Abbreviation GenPept Length ALR2450 ALR1310 ALR0627 AQ_720 BH1415 BT4305 (a- amylase) CAC2414 a- Amylase (amyA) Gll1326 MJ1611 (a- amylase) MA4053 (a- amylase) MA4052 (a- amylase) MM0861 (a- amylase) ... AAL80396.1 AAB71229.1 AAL82059.1 BAA29442.1 BAA30492.1 BAA30120.1 BAA29262.1 BAA22062.1 CAD72460.1 AAN56266.1 AAK41260.1 AAK41420.1 BAB65830.1 BAB66135.1 BAC09526.1 BAC08829.1 BAC09822.1 BAA18743.1 BAA10043.1...

Ngày tải lên: 19/02/2014, 12:20

... kinetic detail, or when the systems are so large that a detailed molecular analysis is beyond reach and modularization is required Because we here analyze at the level of complete molecular detail ... degradation (–ajsajs) and a second influence through its autocatalytic feedback (+ajsbjs) through the same reaction, vs The latter influences cancel each other, again as all stoichiometries are ... is negative As Graph (3) will be part of a larger network, whether it actually will be able to cause instability (oscillations) depends on whether the precise kinetic parameter values make its...

Ngày tải lên: 19/02/2014, 16:20