... _ (a) (b) Fig 3.5 (a) The steerer table and (b) the 90° analyzing magnet on the analyzer table Source: [33] On both steerer and analyzer tables, a beam profile monitor (BPM) anda faraday cup ... buildup and tank sparks Other forms of electrical insulation are the vacuum and glass insulation within the accelerator tube, the plastic support members in the power supply anda variety of insulating ... probe, and the resultant ion beam is focused by applied voltage at the extraction electrode A set of permanent magnets apply an axial magnet field to create a toroidal motion of electrons that concentrates...
... load lock chamber (a) (b) Goniometer Gate Valve V1 V1 Main Chamber Load lock chamber (c) Main chamber Main viewport Fig 3.7 (a) Main chamber, goniometer and load lock (b) Load lock with a sample ... goniometer attachment in the main chamber from a load-lock chamber through a gate valve A controller program at the control cabinet oversees the vacuum interlocks system and allows for programmed or manual ... orientation within the main chamber It allows for translation in the x, y θ Motor and z axes, as well as rotation about the θ and φ axes (Fig 3.9) The translation resolution is 0.01 mm with a repeatability...
... points along the MCP and are plotted out and compared to results from the Matrix and Numerical calculations as well as the experimental data at the end of this chapter The layout of the Direct calculations ... boundary edges are filed at an angle of 45° at both the magnet entrance and exit 4.6.2 Maxwell’s and Laplace’s equations The general Maxwell’s equations for electric and magnetic fields in vacuum ... fragments need to be scaled to the same integrated charge As such, the average counts of n channels on each side of each of the boundaries between the fragments are calculated anda linear scale...
... experimental data was compared to the SIMION and the analytical calculations……………… 81 List of Figures xvii 5.1 (a) Plot of different sets of calibration data measured at approximately months interval ... Schematic and layout of the installation of the electrostatic plates……… 100 5.13 Scaled diagram of the layout of the electrostatic plates relative to the MCP, as well as the calculated ion trajectories ... SiOxNy and Hf-based films will have to be used Lanthanide (Rare-Earth)-based films are one of the candidates for high-k replacements as they have large band gaps, high dielectric constants and low...
... detail References Francis Bond, Sanae Fujita, Chikara Hashimoto, Kaname Kasahara, Shigeko Nariyama, Eric Nichols, Akira Ohtani, Takaaki Tanaka, and Shigeaki Amano 2004 The Hinoki treebank: A treebank ... Ooyama, and Yoshihiko Hayashi 1997 Goi-Taikei — A Japanese Lexicon Iwanami Shoten, Tokyo volumes/CDROM Kaname Kasahara, Hiroshi Sato, Francis Bond, Takaaki Tanaka, Sanae Fujita, Tomoko Kanasugi, ... 1998 WordNet: An Electronic Lexical Database MIT Press Chikara Hashimoto, Francis Bond, Takaaki Tanaka, and Melanie Siegel 2005 Integration ofa lexical type database with a linguistically interpreted...
... Claw and Berkeley (8) Data from Nakamura et al (24) Data from Trinkunaite et al (34) f Data from Kitahara and Suzuki (17) and Kandler and Weiss (15) g ND, not determined Nearly homofermentative according ... strain by Nakayama and Yanoshi (25) and as a B coagulans strain by Blumenstock (6) MA.TERIALSAND METHODS Bacterial strains The Bacillus strains used in this study are listed in Table Seven strains ... lecithinase activity, degradation of tyrosine, reduction of nitrate to nitrite, utilization of citrate or propionate, formation of indole, and deamination of phenylalanine DISCUSSION Nakayama and Yanoshi...
... Trade Organizations ASEAN Association of Southeast Asian Nations IMF International Monetary Fund APEC Asia - Pacific Economic Cooperation ASEM Asia - Europe Meeting VCCI Chamber of Commerce and Industry ... following law and regulations of the organizations Everywhere and every country have its own law and regulation so that each organization operating in one place has to follow the law and regulation of ... obtain secondary data However, secondary data has disadvantage, which is that the information may be not available Thus, if the researchers want to get effective secondary data, they must evaluate...
... Estimating the accounting system of Savina After having analyze about accounting system information of Savina, the advantages and disadvantages are below The outstanding strengths of the current accounting ... than the opportunities, as well as analyze and explain the changes in the area of methodology and organization ofa company, after activity-based costing implementation The research findings are ... Organizational structure was classified into organic and mechanistic by Stalker and Burns [25], organic organizations have lower level of formalization and centralization than that of mechanistic...
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... extracellular signal-regulated kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of ... Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT (PstI site underlined;...
... (each) orange with black lateral band or center mostly orange orange with black lateral band or center black, rarely with weak2 orange lateral band black, rarely with weak2 orange lateral band ... tredecim (Walsh and Riley) M septendecim (L.) 13 M cassini (Fisher) 17 M tredecassini Alexander and Moore 13 M septendecula Alexander and Moore 17 M tredecula Alexander and Moore 13 13 17 Abdominal sternite ... conditions against an acoustic background ofa Magicicada chorus located in woods approximately m away and containing all four 13-year species Females were tested in groups of four, in random order...
... to measure the height of each building Hence it is not a real full 3D database but a 2.5D database, in a dat format similar to the one used by commercial RO software After calibration based on ... second component of the combined approach of this paper 2.3 Comparison RO models and FD models are very different and both of them have advantages and drawbacks Comparisons between them have been developed ... Tracing and Ray Launching where: (i) ray Launching emits the rays from the transmitter Signal strength degenerates as the rays propagate and additional loss is added when rays reflect or diffract...
... and branching pattern analysis Statistical processing of computed coordinates allows the calculation of some root architectural characteristics Each root is specified in terms of elongation and ... computing of growth and ramification parameters Table I shows the final data structure of the simplified example from Fig Discussion This new data ;acquisition system allows a quantitative analysis of ... introduced, 4) the virtual segment is automatically deleted; the coordinates of branch point andof final point of virtual segments; and 5) the rank of branch point a Final data structure: ments resorting...
... of Manitoba, Winnipeg, Canada 2CancerCare Manitoba, Winnipeg, Canada 3Tom Baker Cancer Centre, Calgary, Canada Faculty of Medicine, University of Calgary, Calgary, Canada 5British Columbia Cancer ... Canadian Institutes of Health Research (#87024) and the Canadian Breast Cancer Research Alliance/Canadian Institutes of Health Research (#89840) Author details Faculty of Nursing, University of ... stakeholders (academics, clinicians, patients, patient advocates) to establish a national direction for research in the area of consultation-recording use in oncology Data management and analysis...
... classes of phenomena Systematic explanation: A theory must provide an explanation of the form and significance of the causal and relational mechanisms at work in cases or classes of the phenomena defined ... in qualitative data analysis in three large studies (of the implementationof e-health technologies [28], the integration of telecare systems [29,30], and the operationalization ofa large randomized ... face validity, and to ask whether the NPM merited formal testing This consisted of two main pieces of work, quantitative data analysis and research synthesis Qualitative data analysis We integrated...
... classes of phenomena Systematic explanation: A theory must provide an explanation of the form and significance of the causal and relational mechanisms at work in cases or classes of the phenomena defined ... in qualitative data analysis in three large studies (of the implementationof e-health technologies [28], the integration of telecare systems [29,30], and the operationalization ofa large randomized ... face validity, and to ask whether the NPM merited formal testing This consisted of two main pieces of work, quantitative data analysis and research synthesis Qualitative data analysis We integrated...
... hematocrit (A) and creatinine levels (B) of the patient Therapy scheme and resultant changes in hematocrit (A) and creatinine levels (B) of the patient Hemodialysis and erythropoietin treatments ... content of the paper EF interpreted patient data and the literature and critically reviewed the content of the paper All authors read and approved the final manuscript Acknowledgements The renal biopsy ... recovery of anemia was sluggish and normalization of hemoglobin levels was observed only in patients with substantial renal recovery To date, anemia has not been reported in ARF associated with adult...
... collection and the analysis and interpretation of the data DL provided statistical assistance CH provided mathematical assistance during the development of SPRINT All authors read and approved the final ... collection and the analysis and interpretation of the data, and helped draft the manuscript T Lonergan and MW helped conceive and develop the SPRINT protocol XWW, JL, and T Lotz assisted in data collection ... SPRINT had Table Comparison of SPRINT and retrospective cohort baseline variables Overall Retrospective Total patients Age, years Percentage of males APACHE II score APACHE II risk of death Diabetic...
... Health Care Quality Assurance • International Journal of Operations and Productions Management • International Journal of Quality and Reliability Management • Journal of American Academy of Business ... qualitative analysis of data from surveys and case studies We focus on both the situation and application of Six Sigma implementationand the factors that affect the implementationof Six Sigma ... Journal of Applied Statistics • Journal of Health Care Management • Journal of Industrial Technology • Journal of Marketing Management • Journal of Operations Management • Journal of Organizational...
... database Khi ta phải rõ vị trí primary data file transaction log file Ví dụ: USE master GO CREATE DATABASE Products ON ( NAME = prods_dat, FILENAME = server\ mssql\data\prods.mdf', SIZE = 4, MAXSIZE ... KB KB Tạo Một User Database Chúng ta tạo database dễ dàng dùng SQL Server Enterprise cách right-click lên "database" chọn "New Database" hình vẽ sau: Sau việc đánh tên database click OK Ngoài ... memory (vùng nhớ gọi data cache), sau data data cache thay đổi(những trang bị thay đổi gọi dirtypage) Tiếp theo thay đổi ghi vào transaction log file người ta gọi write-ahead log Cuối trình gọi...