a decade of discoveries

thomas and patnaik-serial correlation in high-frequency data and the link with liquidity

Ngày tải lên : 24/04/2014, 00:23

... up and filtering of intraday data (Dacorogna et al., 2001) The specifics of data-filtering and cleaning for HF data from the NSE can be found in Patnaik and Shah (2002) Concatenation of data across ... stocks by trading intensity: Bank of Baroda and Dabur Industries for the period from March 1999 to February 2001 Variance Ratio (BANKBARODA) Variance Ratio Statistics(BANKBARODA) Variance Ratio 95% ... data that can be observed at intervals that are as small as a second The analysis of serial correlations with such high frequency data is particularly interesting for several reasons One reason...

26
422
0

CURRENCY BOARD OR CENTRAL BANK? Lessons from the Irish Pound''''s Link with Sterling, 1928-79 ppt

Ngày tải lên : 06/03/2014, 14:20

... peg of CFA 50 to FF was replaced by a 100 to peg in January 1994 27 As the financial and fiscal system of a country matures, the apparent advantages of a currency board may eventually wear thin, ... the vast bulk of Irish trade and apparently represented as stable a currency as was then available The substantial degree of financial integration between Ireland and the UK was also important ... Central Bank of Ireland act as a currency board? In order to assess for how long the Central Bank of Ireland continued to act as a currency board in matters of monetary management, despite the fairly...

39
480
0

Báo cáo khoa học: On the aggregation properties of FMRP – a link with the FXTAS syndrome? pot

Ngày tải lên : 14/03/2014, 23:20

... microscopy analysis and Steve Howell for mass spectrometry analysis We are grateful to Cesira de Chiara and Laura Masino for critical discussion and assistance in graphic elaboration of CD results We acknowledge ... ﬁbrils with an average diameter of nm (Fig 6C) FX1RP Nt-NES aggregates have a curved appearance, with an apparent average diameter of 10 nm (Fig 6D) They also clustered together and were often found ... & Pastore A (2010) Functional interactions as a survival strategy against abnormal aggregation FASEB J 25, 45–54 32 Adrover M, Pauwels K, Prigent S, de Chiara C, Xu Z, Chapuis C, Pastore A &...

10
415
0

Báo cáo y học: "Deafblindness in French Canadians from Quebec: a predominant founder mutation in the USH1C gene provides the first genetic link with the Acadian population" ppsx

Ngày tải lên : 14/08/2014, 20:22

... major impact on diagnostic and clinical management of deaf children in Quebec Although Acadians and Quebecers are both French Canadian, Acadia was founded four years prior to Quebec and in a ... following additional data are available with the online version of this paper Additional data file is a figure showing refereed research Additional data files deposited research USH1C mRNA, isoform ... The family of an Acadian USH1 patient that has previously been shown to be homozygous for the Acadian founder mutation, c.216G >A [5], was available for haplotype analysis USH1C haplotypes are...

8
271
0

Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"

Ngày tải lên : 25/10/2012, 11:18

... minimal invasiveness and accurate targeting with a real-time US guide allow HIFU to precisely ablate lesions of large size, irregular shape, and even multi-modularity A major advantage of HIFU ... vacuolated, and mitochondria swelled to a circular shape with a clear matrix and short or disappeared cristae, which were vacuolar appearances Smooth and rough endoplasmic reticulum expanded and became ... Ltd Tokyo, Japan) Statistical analysis Data were expressed as means ± standard deviation (SD), and comparisons were performed with Wilcoxon rank sum test All statistical analyses were carried out...

7
481
0

Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"

Ngày tải lên : 26/10/2012, 08:57

... GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT 3’) primers were used as published (24) µl of DNA was added to reaction mixture containing ... Galita DA, et al Detection of Chlamydia pneumoniae in a bilateral orbital mucosa-associated lymphoid tissue lymphoma American Journal Of Ophthalmology 2006 Jun; 141(6): 1162-3 Carter JD, Gérard ... attempt to evaluate the prevalence of C pneumoniae bacteremia in cardiovascular patients we used a combination of cell culture technique with further evaluation of isolates by PCR That approach...

10
782
0

INTRODUCTION TO THE CRACKING WITH OLLYDBG FROM CRACKLATINOS P3

Ngày tải lên : 19/10/2013, 14:15

... crackmes.de, thank to all members of unpack.cn (especially fly and linhanshi) Great thanks to lena151(I like your tutorials) And finally, thanks to RICARDO NARVAJA and all members on CRACKSLATINOS ... câu l nh Add EAX, Sau thay đ i xong quan sát k t qu thay đ i c a s CPU Trư c b n th c thi câu l nh ADD EAX,1 – s quan sát giá tr c a c a c OF Ta có đư c k t qu sau : Okie, lúc giá tr c a c tràn ... TQN, HacNho, RongChauA, Deux, tlandn, light.phoenix, dqtln, ARTEAM all my friend, and YOU ++ ==[ Thanks To ]== ++-iamidiot, WhyNotBar, trickyboy, dzungltvn, takada, hurt_heart, haule_nth, hytkl...

14
862
3

INTRODUCTION TO THE CRACKING WITH OLLYDBG FROM CRACKLATINOS P2

Ngày tải lên : 19/10/2013, 14:15

... crackmes.de, thank to all members of unpack.cn (especially fly and linhanshi) Great thanks to lena151(I like your tutorials) And finally, thanks to RICARDO NARVAJA and all members on CRACKSLATINOS >>>> ... members, TQN, HacNho, RongChauA, Deux, tlandn, light.phoenix, dqtln, ARTEAM all my friend, and YOU ++ ==[ Thanks To ]== ++-iamidiot, WhyNotBar, trickyboy, dzungltvn, takada, hurt_heart, haule_nth, ... REA Hi v ng b n s ti p t c phát huy ☺ I want to thank Teddy Roggers for his great site, Reversing.be folks(especially haggar), Arteam folks(Shub-Nigurrath, MaDMAn_H3rCuL3s) and all folks on crackmes.de,...

9
669
1

Franklin Road Academy Prepares for the Future With ADC’s CopperTen® 10-Gigabit Cabling

Ngày tải lên : 22/10/2013, 17:15

... director of IT at Franklin Road Academy, considered total cost of ownership and decided to implement ADC’s 10-gigabit CopperTen copper cabling to last a minimum of 20 years Head of School Dr Margaret ... state -of- the-art math and science building, and a library and technology center For horizontal cabling in each of the four facilities, FRA selected ADC’s CopperTen® plenum cabling An integral part of ADC's ... renovation of the upper school building that houses humanities and social studies, and the south campus that houses foreign language classrooms At the same time, planning began for a new state -of- the-art...

4
336
0

Tài liệu Creating Applications with Mozilla-Chapter 7. Extending the UI with XBL- P1 pptx

Ngày tải lên : 14/12/2013, 12:15

... An NCName is the part of a namespace declaration that qualifies the markup type for that particular namespace It is placed after a colon, and in many XPFE documents, is the markup language name ... other markup, remember to distinguish between the XBL markup (such as and ) and markup from another language (such as XUL) Namespaces are a feature of the XML language that was ... a more detailed discussion of its characteristics and how to programmatically gain access to the content Attachment and detachment Attachment is the process through which a binding is associated...

17
367
0

Tài liệu Creating Applications with Mozilla-Chapter 7. Extending the UI with XBL- P2 pptx

Ngày tải lên : 14/12/2013, 12:15

... contained within its own tag

11
390
0

Tài liệu Creating Applications with Mozilla-Chapter 7. Extending the UI with XBL- P3 docx

Ngày tải lên : 14/12/2013, 12:15

... rather than a list This node is qualified by an element name, a particular attribute, and the value of that attribute, and returns this specific node This retrieval provides faster access to anonymous ... new SOAPParameter(this.start, "start"), new SOAPParameter(this.maxResults, "maxResults"), new SOAPParameter(this.filter, "filter"), new SOAPParameter(this.restrict, "restrict"), new SOAPParameter(this.safeSearch, ... input, you may not want to load a binding until certain values are entered For example, in a membership database, the information that appears on screen may depend on the user's level of membership...

12
353
0

Tài liệu Creating Applications with Mozilla-Chapter 7. Extending the UI with XBL- P4 pptx

Ngày tải lên : 14/12/2013, 12:15

... documents are designed to be modular, self-contained widgets that have a certain appearance and carry out a specific set of functionality This final section extends the notion of XBL as an organization ... two attributes, applyauthorstyles and styleexplicitcontent, can affect the appearance of a binding element if a stylesheet is applied to it Although they are part of the XBL 1.0 specification, ... take advantage of inherent behaviors in other elements or inherit from other bindings Mozilla buttons are a mix of , , and elements, and they take on the characteristics of each...

19
311
0

Tài liệu The Problem with Objects docx

Ngày tải lên : 15/12/2013, 00:15

... transparently, they add a performance overhead as they involve dynamic memory allocations While this overhead is small for each item, it adds up when a program creates queues of large numbers of value types ... disadvantage of using the object approach to create generalized classes and methods is that it can use additional memory and processor time if the runtime needs to convert an object into a value ... (Clock)myQueue.Dequeue(); Although this code will compile, it is not valid and throws a System.InvalidCastException at runtime The error is caused by trying to store a reference to a Circle in a Clock variable, and...

2
341
0

Tài liệu INTRODUCTION TO THE CRACKING WITH OLLYDBG FROM CRACKLATINOS doc

Ngày tải lên : 22/12/2013, 21:18

... crackmes.de, thank to all members of unpack.cn (especially fly and linhanshi) Great thanks to lena151(I like your tutorials) And finally, thanks to RICARDO NARVAJA and all members on CRACKSLATINOS ... crackmes.de, thank to all members of unpack.cn (especially fly and linhanshi) Great thanks to lena151(I like your tutorials) And finally, thanks to RICARDO NARVAJA and all members on CRACKSLATINOS >>>> ... his great site, Reversing.be folks(especially haggar), Arteam folks(Shub-Nigurrath, MaDMAn_H3rCuL3s) and all folks on crackmes.de, thank to all members of unpack.cn (especially fly and linhanshi)...

55
1.2K
2

Tài liệu Helping the elderly with activity limitations docx

Ngày tải lên : 14/02/2014, 06:20

... children and 4% 7% O N 53% NO CAREGIVER AVAILABLE SOURCE: National Academy on an Aging Society analysis of data from the 1993 study of Assets and Health Dynamics Among the Oldest Old A N A G I N ... the data presented in this Profile are from Wave of the study of Assets and Health Dynamics Among the Oldest Old (AHEAD) The AHEAD data set provides information about respondents age 70 and older ... 2010 2020 2030 YEAR SOURCE: National Academy on an Aging Society analysis of data from the 1993 study of Assets and Health Dynamics Among the Oldest Old and U.S Census Bureau population projections...

6
451
0

Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx

Ngày tải lên : 16/02/2014, 14:20

... mutant, 5Â- ACC CAA GCC AAG GAG GCC GAC TTT CTA TTT GCC GCC AAC GGA3Â and 5Â-TCC GTT GGC GGC AAA TAG AAA GTC GGC CTC CTT GGC TTG GGT-3Â (the altered codons are shown in bold) After verication of ... TGC GAG GTT GGC TAC GGC-3Â; for the C27 6A C28 2A mutant, 5Â-GGC GTA GCT ACA ATG GCG AAG CAT GCC GGA CAT-3Â and 5Â-ATG TCC GGC ATG CTT CGC CAT TGT AGC TAC GCC-3Â; and for the C33 9A C34 2A C34 8A ... Benjdia A, Leprince J, Guillot A, Vaudry H, Rabot S & Berteau O (2007) Anaerobic sulfatase-maturating enzymes: radical SAM enzymes able to catalyze in vitro sulfatase post-translational modication...

15
559
0

Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deﬁciency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

Ngày tải lên : 18/02/2014, 06:20

... marker and may have provided more reliable information In summary, increased visceral adiposity is associated with increased proinflammatory factors such as increased PAI-1, TNFa, leptin, IL-6 and angiotensinogen, ... important role of androgens in vascular health and erectile function Summary and conclusions Visceral obesity, in particular, is characterized by increased inflammatory factors, decreased plasma TT ... 116–119 Maggio M, Blackford A, Taub D, Carducci M, Ble A, Metter EJ, Braga-Basaria M, Dobs A & Basaria S (2006) Circulating inflammatory cytokine expression in men with prostate cancer undergoing androgen...

13
662
0

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Ngày tải lên : 19/02/2014, 08:20

... GST-ExoS(D42 7A) 17 GST-ExoS(L42 8A) 18 GST-ExoS(LD426–427AA) Amersham S419QGLLDALDL428 M419AAAA428 S419QGLLDAAAA428 S419QGLLAAAAA428 S419QGLLAALAL428 I419QGLLDALDL428 S419AGLLDALDL428 S419QALLDALDL428 ... evolution has created a new way to take advantage of an evolutionary ‘novel’ eukaryotic 14-3-3 protein family, using them as a necessary cofactor to activate lethal bacterial toxins, 644 but only after ... ExoS(D42 4A) , ExoS(L42 6A) , ExoS(D42 7A) , ExoS(L42 8A) , ExoS(D42 4A; D42 7A) , ExoS(LDL426– 428AAA) and ExoS(LD426–427AA) into target cells The cells were then harvested and the resultant lysate was separated...

9
525
0