a critical tool for sustainable development

Báo cáo khoa học: "A Graphical Tool for GermaNet Development" ppt

Báo cáo khoa học: "A Graphical Tool for GermaNet Development" ppt

... well This would mean that the wordnet data for a given language would have to be stored in a relational database and that the tool itself can handle the language specific data structures of the ... displayed It is possible to edit the examples and frames associated with a lexical unit via the Examples and Frames tab Frames specify the syntactic valence of a lexical unit Each frame can have an ... frame can have an associated example that indicates a possible usage of the lexical unit for that particular frame The tab Examples and Frames is thus particularly geared towards the editing of...

Ngày tải lên: 17/03/2014, 00:20

6 349 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... doing so, the consensus on the problems and  their solutions can be reached. However, it is  noted that MCA is subjective in its nature. In  case  the  quantitative  data  are  available,  quantitative  analysis  (i.e.  numerical  ... own  advantages  and  disadvantages.  Table  1  summarizes  some  these methods and their features.  In  comparison  with  the  ranking  and  rating  methods,  pairwise  comparison  and  trade‐off ...

Ngày tải lên: 22/03/2014, 12:20

13 488 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

... Klabin and Aracruz that present data for years 2003, 2004 and 2005 and Cenibra which data are available only for 2005 ** The companies not have this value calculated All plants, excepting Aracruz and ... performance; and they can contribute to the human capital formation for the sector International Standart Organization - ISO Forest Stewardship Council - FSC The Brazilian Association for Pulp and Paper ... indicators lower than Cenibra in all parameters Votorantim, Suzano Bahia Sul, Ripasa and International paper are integrated producers of the writing and printing paper By calculating the average of the...

Ngày tải lên: 22/02/2014, 09:20

23 895 0
Báo cáo khoa học: "A Debug Tool for Practical Grammar Development" doc

Báo cáo khoa học: "A Debug Tool for Practical Grammar Development" doc

... of Japan SIG Notes NL-127, pages 173–178, September In Japanese Takashi Miyata, Kazuma Takaoka, and Yuji Matsumoto 1999 Implementation of GUI debugger for unification-based grammar In Information ... prepositional phrases are annotated manually The tags not always specify the correct structures based on rental-XTAG (i.e., the grammar assumed by tags is different from rental-XTAG), so we prepared a ... pages 38–45 Koiti Hasida 2003 Global document annotation (GDA) available in http://www.i-content.org/GDA/ Hisao Imai, Yusuke Miyao, and Jun’ichi Tsujii 1998 GUI for an HPSG parser In Information...

Ngày tải lên: 08/03/2014, 04:22

4 361 0
Team-teaching as a tool for professional development - insiders' views = Dạy cặp như một phương tiện phát triển nghề nghiệp quan điểm của người tham gia

Team-teaching as a tool for professional development - insiders' views = Dạy cặp như một phương tiện phát triển nghề nghiệp quan điểm của người tham gia

... then transcribed for data analysis The data transcripts consisted of 15 pages for field notes and 50 pages for interviews 2.6 Data analysis 25 Once the researcher had obtained all the data transcripts ... research into how to overcome its barriers 1.3 Why team-teaching as a valuable means for professional development? The study of team-teaching as a viable alternative to traditional teaching as a ... in a team-teaching handbook for American educators In case of team-teaching between two Vietnamese teachers, only the case of team-teaching between a veteran teacher and an inexperienced teacher...

Ngày tải lên: 19/03/2015, 10:33

59 391 0
Industrial design strategies for sustainable development  a case study of the packaging industry in singapore

Industrial design strategies for sustainable development a case study of the packaging industry in singapore

... goals of the Singapore Packaging Agreement.” 3R Packaging Awards 2008 Communication Folder The Singapore Star Award The Asia Star Awards are organised annually by the Asian Packaging Federation ... plans for the continuous development of the country It was created in January 2008 to formulate a national strategy for Singapore’s sustainable development regarding domestic and global challenges ... following presentation They are: • A profile of the packaging industry of Singapore regarding sustainable development initiatives with respect to local and global scenarios; • A critical analysis of...

Ngày tải lên: 12/10/2015, 17:36

136 757 0
Climate change and variability in vietnam and strategiesto be addapted on agriculture for sustainable development

Climate change and variability in vietnam and strategiesto be addapted on agriculture for sustainable development

... change and variability on agriculture, forestry and food security inVietnam and strategies to be adapted on agriculture; Preparation the Vietnam- National Adaptation Programmes of Action (NAPA) ... delta + North central + South central + Central plateau + North eat south + Mekong river delta ASSESSMENT CLIMATE CHANGE AND VARIABILITY IN VIETNAM Air average temperature.Long term variation and ... following equations: Rice yield can find in following equations: STRATEGIES TO BE ADAPTED ON AGRICULTURE FOR SUSTAINABLE DEVELOPMENT Adaptation isan automatic or planned activity that minimises adverse...

Ngày tải lên: 23/09/2012, 15:10

28 708 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... 84-90 Stathopoulos GP, Koutantos J, Vaslamatzis MM, Athanasiadis A, Papadopoulos G, Labrodimou G, Stathopoulos J, and Rigatos S Survival after cytotoxic chemotherapy in patients with advanced hormone-resistant...

Ngày tải lên: 26/10/2012, 09:48

10 408 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

Ngày tải lên: 31/10/2012, 14:59

11 716 0
The UN Model Double Taxation Convention in the context of Financing for Sustainable Development

The UN Model Double Taxation Convention in the context of Financing for Sustainable Development

... Provide a framework for dialogue with a view to enhancing and promoting cooperation among national tax authorities and assess how new and emerging issues could affect this cooperation • Make recommendations ... international tax treaty practice The UN Model Convention seeks to assist developing countries in drafting and negotiating bilateral tax treaties, with a view to maintaining the desired balance What ... Double Taxation Convention Models are generally used by countries as a Double Taxation Convention Models important? Why are basis for the negotiation of their bilateral treaties; thus they have a profound...

Ngày tải lên: 05/09/2013, 14:19

14 489 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

... and its derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA ... ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL *******NNN *******SSS *******PPP chloroplasts used for this assay [15] Furthermore, the intermediate and mature forms of Toc75 in a ... apparatus, faces the stromal compartment J Biol Chem 273, 16583–16588 Gunasekaran K, Nagarajaram HA, Ramakrishnan C & Balaram P (1998) Stereochemical punctuation marks in protein structures: glycine and...

Ngày tải lên: 19/02/2014, 07:20

9 497 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... degradation (–ajsajs) and a second influence through its autocatalytic feedback (+ajsbjs) through the same reaction, vs The latter influences cancel each other, again as all stoichiometries are ... they are not branched and correspond to any step between two substances in graphs such as Graph (1), i.e any path that involves a single chemical reaction One actual chemical reaction may effect a ... not have steady states on its border, all phase trajectories lead inward Steady states on the border are readily identified ([21] and an example below) That am be positive and (i < m) be negative...

Ngày tải lên: 19/02/2014, 16:20

11 639 0
Tài liệu A New Paradigm for Economic Development docx

Tài liệu A New Paradigm for Economic Development docx

... academic patents awarded to academic researchers in each state, relative to the number of science and engineering doctorate holders in academia California, Massachusetts, Florida, Maryland, and ... Research Triangle Park The idea for a research park in the Raleigh-Durham-Chapel Hill area began in the 1950s, spawned by a disparate cast of characters that included bankers, professors, real ... Utah Iowa North Carolina Alaska 10 Alabama Based on state and local spending per capita on higher education For details see Table 10 Rockefeller Institute Page 47 www.rockinst.org Higher Education...

Ngày tải lên: 20/02/2014, 19:20

74 410 0
Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc

Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc

... the media has a very important role to play in advocating for a more sustainable future Media can share information and knowledge thus raising public awareness The media can also change attitudes, ... Nations Decade of Education for Sustainable Development The United Nations Decade of Education for Sustainable Development is a complex and farreaching undertaking The environmental, social, and ... identification of suitable and relevant indicators at every level – local, national, regional and international – and for each initiative and programme As the Decade puts major emphasis on cooperation...

Ngày tải lên: 21/02/2014, 17:20

27 632 0
Tài liệu Technology and Policy for Sustainable Development pot

Tài liệu Technology and Policy for Sustainable Development pot

... technologies for sustainable development The technological potential for more sustainable patterns of production and consumption is great We have seen a rapid and important transmaterialisation away from ... is a way to gradually establish a new balance between old physical capital, the investment of the past, and natural resources Thus, a successful strategy for sustainable development has to be an ... environmental impact Both the environmental management systems and the LCA-analyses uses as well as creates considerable amounts of information Fortunately, there are several IT-based environmental information...

Ngày tải lên: 22/02/2014, 09:20

38 391 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

... interventions A New Tool for Scaling Impact 15 15 outcomes (such as smoking cessation) are achieved Foundations could act as payor via performance-based grants on projects that have large societal value, ... Collaboration with relevant government agencies will also be necessary to gain access to administrative data, such as Medicaid records Administrative data will allow evaluators to assess program ... risks, as well as financial and social returns, are properly articulated and managed They will require tools, such as a credit scorecard, that reflect an intermediary’s methodical and careful...

Ngày tải lên: 06/03/2014, 08:20

36 262 0
ENVIRONMENT SCIENCE AND POLICY FOR SUSTAINABLE DEVELOPMENT: GREEN MARKETING docx

ENVIRONMENT SCIENCE AND POLICY FOR SUSTAINABLE DEVELOPMENT: GREEN MARKETING docx

... several reasons for the Prius’ market demand Initially, the buzz over the Prius got a boost at the 2003 Academy Awards when celebrities such as Cameron Diaz, Harrison Ford, Susan Sarandon, and ... S by Jacquelyn A Ottman, Edwin R Stafford, and Cathy L Hartman U.S Environmental Protection Agency’s (EPA) Energy Star label Repositioning CFL bulbs’ features into advantages that resonated with ... marketing is making a comeback.5 The need for sustainability has become more acute economically as soaring demand, dwindling supplies, and rising prices for oil, gas, coal, water, and other natural...

Ngày tải lên: 06/03/2014, 21:20

17 532 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... membrane was from Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin ... the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam

corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam

... of paramount importance Models of sustainable development in Vietnam is formed on the basis of empirical research and, in accordance with the actual and desired by local managers 1.3 Small and ... 2.1.4 - Natural Environment Bac Ninh has natural conditions, a favorable geographical position have created for the Bac Ninh region soon became an agricultural civilization long development, a unique ... paper for special offers for Han Nom Institute The handicraft products are outstanding, furniture Dong Ky, Quang Dong, Tu Son has known a large area and exported to China, Taiwan, Thailand, Laos,...

Ngày tải lên: 13/03/2014, 14:20

69 577 0
w