a critical comparison of seismic and tsunami wave inversions

A comparison of real and simulated designs for vibratory parts feeding

A comparison of real and simulated designs for vibratory parts feeding

... Jayaraman Krishnasamy, Mark J Jakiela, and Daniel E Whitney Mechanics of vibration-assisted entrapment with application to design In International Conference on Robotics and Automation IEEE, April ... equivalence classes of stable states, and it then automatically categorizes the state (and hence, the equivalence class) of each part as the part exits the gate Experimental Results All of the ... systematic comparison of quasi-static algorithmic and Monte Carlo simulated approaches to physical experiments [13] Krishnasamy, Jakiela, and Whitney analyzed vibration-assisted entrapment of both...

Ngày tải lên: 03/01/2014, 19:15

6 600 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

... combination of a- and b-subunits, each a- subunit bearing an Fe2S2 cluster and a mononuclear iron site [208] Two histidines and one bidentate aspartate ligand, the socalled ễ2-His-1-carboxylate facial ... dismutase or catalase, implicating the involvement of a peroxo adduct in catalysis [243] In fact, reactivity was enhanced when H2O2 was the oxidant in place of reductant and air [243], and the putative ... radical rearrangements [98,312] On the other hand, the timing of radical rearrangement (radical clocks) may depend critically on the tightness of the radical cage and the ensemble of steric and...

Ngày tải lên: 19/02/2014, 16:20

26 747 0
Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx

Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx

... operators of conventional dairies that go through what can be a challenging and costly transition process Many changes in such areas as animal husbandry, land and crop management, sourcing new and ... farms adopting the organic approach because of access to high quality pastures and the ability to manage pasture as a dairy feed source These areas also have a long history of small dairy operations ... standard normal density function and Φ is the standard normal cumulative distribution function evaluated using the first stage estimates Characteristics and Practices of Conventional and Organic...

Ngày tải lên: 22/02/2014, 05:20

30 661 0
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx

Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx

... investigation and choice of dialects are presented Part II provides an overview of the tones and intonation of the Vietnamese language This lays the basis for comparing aspects of Vietnamese intonation ... used as the native language and English as the target language The Vietnamese word structure and the Vietnamese tones, intonation Generally, there are two aspects in Vietnamese that make the language ... intonation to Vietnamese EFL learners The pronunciation mistakes made by people learning to speak a foreign language are almost always carry-overs from their native languages Through a comparison...

Ngày tải lên: 05/03/2014, 12:20

10 2K 17
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal ... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1 ⁄ VPS4 impairs membrane trafficking out of endosomal ⁄...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

... La Jolla, CA, USA) with pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, ... Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and Met95 mutants of the isolated ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...

Ngày tải lên: 16/03/2014, 13:20

14 390 0
Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt

Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt

... paragraph as important, and the other sentences as not important We included this approach merely as a simple baseline 2.2 Word-based approaches Word-based approaches to summarization are based ... Cambridge, MA, USA: MIT Press Daniel Marcu 2000 The theory and practice of discourse parsing and summarization Cambridge, MA: MIT Press Mandar Mitra, Amit Singhal, & Chris Buckley 1997 Automatic ... statistical tests, we collapsed the data for each text for the WithParagraph and the NoParagraph condition, and treated them as one experiment Figure shows that when the data from Experiments and...

Ngày tải lên: 17/03/2014, 06:20

8 415 0
Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

... binding a nities, and the hypocalcemic potencies in vivo of hCt, sCt, analogues 1–6 and/ or the partial sequence analogues 1a, 1b, 2a, and 3a The CD data of the partial sequence analogues 1a, 1b, 2a, ... equilibrium state and that it 784 A Kazantzis et al (Eur J Biochem 269) Ó FEBS 2002 Fig Far-UV CD spectroscopy of hCt and analogues 1–6 (A, C) and 1a, 1b, 2a, and 3a (B,D) in aqueous buffer (A, B) and in ... I and II b turn spectrum according to Brahms and Brahms [28] that exhibits a characteristic minimum at about 225 nm and a maximum at 210–220 nm The spectra of 1a and 1b were very similar to each...

Ngày tải lên: 31/03/2014, 21:21

12 448 0
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

... derivatives Lane 1, purification of the His6-tagged HspH variant; lane 2, His6-tagged HspH variant and untagged HspH after copurification (B) Interaction of tagged and untagged HspH(Na) Lane 3, ... oligomerization principles of bacterial a- Hsp proteins have received little attention Available data indicate that a- Hsp proteins from prokaryotes and plants may differ significantly from their mammalian ... indicate amino acids that are identical in at least 80 or 60% of all proteins, respectively Arrows mark truncations introduced to HspH and HspF, and asterisks indicate alanine exchange mutations...

Ngày tải lên: 31/03/2014, 21:21

9 467 0
báo cáo sinh học:" Health workforce responses to global health initiatives funding: a comparison of Malawi and Zambia" docx

báo cáo sinh học:" Health workforce responses to global health initiatives funding: a comparison of Malawi and Zambia" docx

... (particularly the Malawi data) and drafting of the article JS participated in data collection, data analysis (particularly the Zambia data) and drafting of the article PD participated in data analysis ... and drafting of the article VM participated in study design, data analysis (particularly the Malawi data) and drafting of the article) AW Page 12 of 13 participated in data collection, data analysis ... Economic and Social Research, University of Zambia, Lusaka, Zambia 4College of Medicine, University of Malawi, Blantyre, Malawi Department of Global Health Development, Faculty of Public Health and...

Ngày tải lên: 18/06/2014, 17:20

13 423 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... Table 2: Missing data, means and end effects for NFAS-4 and NFAS-5 items (N = 3325) Missing % NFAS-4 NFAS-5 Walking/standing Standing Walking less than a kilometre on flat ground Walking than ... 1995, 3 1A: 2260-2263 Nagata C, Ido M, Shimizu H, Misao A, Matsuura H: Choice of response scale for health measurement: comparison of 4, 5, and 7-point scales and visual analog scale J Epidemiol 1996,...

Ngày tải lên: 18/06/2014, 22:20

9 489 0
báo cáo hóa học: " A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel" doc

báo cáo hóa học: " A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel" doc

... Journal of Occupational Medicine and Toxicology 2011, 6:10 http://www.occup-med.com/content/6/1/10 Page of Table Means, standard deviations and comparison between the sample available at T1 only and ... of occupational stress in urban EMT-paramedics [see comment] Ann Emerg Med 1989, 18:1151-1156 Mahony KL: Management and the creation of occupational stressors in an Australian and a UK ambulance ... Table Bivariate Pearson’s correlations between independent variables measured at T1 and job satisfaction, emotional exhaustion, psychological distress and musculoskeletal pain measured at T1 and...

Ngày tải lên: 20/06/2014, 00:20

9 532 0
báo cáo hóa học:" Do visual analogue scale (VAS) derived standard gamble (SG) utilities agree with Health Utilities Index utilities? A comparison of patient and community preferences for health status in rheumatoid arthritis patients" pptx

báo cáo hóa học:" Do visual analogue scale (VAS) derived standard gamble (SG) utilities agree with Health Utilities Index utilities? A comparison of patient and community preferences for health status in rheumatoid arthritis patients" pptx

... by a grant from the Canadian Arthritis Network (a National Centre of Excellence) Dr Marra is supported by a Canadian Arthritis Network Scholar Award, and a Michael Smith Foundation for Health ... determine quality of life of an individual are captured and summarized as a global score In VAS and SG valuation methods, however, the individual evaluates his or her own health state based on a holistic ... directly "assesses" and "evaluates" a health state on a scale of 0.00 (death) to 1.00 (perfect health) The health states that are evaluated in the direct approach can be hypothetical or can be the...

Ngày tải lên: 20/06/2014, 15:20

10 603 0
báo cáo hóa học: " A comparison of conventional and retrospective measures of change in symptoms after elective surgery" pptx

báo cáo hóa học: " A comparison of conventional and retrospective measures of change in symptoms after elective surgery" pptx

... tau b and Kappa statistics were used to examine the associations between conventional and retrospective values Spearman’s rank correlation and Kendall’s tau b are non-parametric measures of association ... symptoms lists (hernia repair and laparoscopic cholecystectomy) and for the global assessment items Statistical Analysis Magnitude and direction of change were calculated for each item of the checklist ... questions are answered more reliably [23] Dawson et al reported that radicular symptoms, frequency and location of pain and the way activities affect pain were recalled with greater accuracy than were...

Ngày tải lên: 20/06/2014, 15:20

9 569 0
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" docx

Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" docx

... and y(t) are the baseband equivalent PA input and output, respectively, a1 and a3 are real polynomial coefficients We assume an amplifier with a unity gain (a1 = 1) and an input amplitude at 1-dB ... EURASIP Journal on Wireless Communications and Networking noise (PN) and ADC quantization and clipping), and allows an efficient operation of the power amplifier (PA) Since the 60 GHz channel has ... Melbourne, Australia, May 2006 [5] D Falconer, S L Ariyavisitakul, A Benyamin-Seeyar, and B Eidson, “Frequency domain equalization for single-carrier broadband wireless systems,” IEEE Communications Magazine,...

Ngày tải lên: 22/06/2014, 19:20

14 350 0
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" doc

Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" doc

... and y(t) are the baseband equivalent PA input and output, respectively, a1 and a3 are real polynomial coefficients We assume an amplifier with a unity gain (a1 = 1) and an input amplitude at 1-dB ... EURASIP Journal on Wireless Communications and Networking noise (PN) and ADC quantization and clipping), and allows an efficient operation of the power amplifier (PA) Since the 60 GHz channel has ... Melbourne, Australia, May 2006 [5] D Falconer, S L Ariyavisitakul, A Benyamin-Seeyar, and B Eidson, “Frequency domain equalization for single-carrier broadband wireless systems,” IEEE Communications Magazine,...

Ngày tải lên: 22/06/2014, 22:20

14 313 0
A Randomized Comparison of Radial-Artery and Saphenous-Vein Coronary Bypass Grafts potx

A Randomized Comparison of Radial-Artery and Saphenous-Vein Coronary Bypass Grafts potx

... up A small observational study recently showed a Health Research Dr Desai is the recipient of a CanadianCollaboraof Health Research Fellowship and a Tailored Advanced 10-year patency rate of ... Operative data are presented in Table As described ocardial infarction (occurring between 31 days and elsewhere,7 a dilute solution of verapamil and pa1 year), additional cardiac surgery, and ... coronary paverine was delivered into 92.3 percent of study angioplasty Hand claudication and thenar pares- radial-artery grafts to prevent spasm Proximal anasthesia, complications potentially related...

Ngày tải lên: 27/06/2014, 00:20

9 201 0
a comparison of sip and h.323 for internet telephony

a comparison of sip and h.323 for internet telephony

... returns an error code and lists the set of features it does understand The client can then determine the problematic feature and fall back to simpler operation The feature names are based on a hierarchical ... hierarchical namespace, and new feature names can be registered with IANA This means that any developer can create new features in SIP, and then simply register a name for them Compatibility ... SIP servers and gateways will need to handle many calls For large, backbone IP telephony providers, the number of calls being handled by a large server can be significant In SIP, a transaction through...

Ngày tải lên: 08/07/2014, 17:03

4 304 0
Báo cáo nghiên cứu khoa học: " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners" ppsx

Báo cáo nghiên cứu khoa học: " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners" ppsx

... investigation and choice of dialects are presented Part II provides an overview of the tones and intonation of the Vietnamese language This lays the basis for comparing aspects of Vietnamese intonation ... used as the native language and English as the target language The Vietnamese word structure and the Vietnamese tones, intonation Generally, there are two aspects in Vietnamese that make the language ... intonation to Vietnamese EFL learners The pronunciation mistakes made by people learning to speak a foreign language are almost always carry-overs from their native languages Through a comparison...

Ngày tải lên: 21/07/2014, 16:21

10 1,1K 4
w