a correlation study with axial computed tomography
báo cáo hóa học:" Different effects of femoral and tibial rotation on the different measurements of patella tilting: An axial computed tomography study" doc
... of patellar taping and bracing on patellar position as determined by MRI in patients with patellofemoral pain J Athl Train 1998, 33:16-20 Guzzanti V, Gigante A, Di Lazzaro A, Fabbriciani C: Patellofemoral ... patellar alignment PTA-G was highly correlated with femoral rotation, and tibial rotation (p < 0.01) PTA-M was highly correlated with femoral rotation, and femoral rotation relative to tibia ... rotation relative to tibia femoral rotation, tibial rotation, and femoral rotation relative to tibia; while PTA-M was negatively correlated with femoral rotation, tibial rotation, and femoral...
- 6
- 554
- 0
the valued relationship between workforce training and economic development a correlation study
... agencies to have a better understanding of the available resources across the state The development of a database to manage and describe what the state had to offer potential industries was a key point ... greater good of community (Gendzier, 1998) The United States trade agreements with Latin American countries, North American Free Trade Agreement (NAFTA) and the Central American Free Trade Agreement ... occurs when partial or an inaccurate collection of data exists As such, supporting material from viable alternative sources can be used to compensate Interpretation threat occurs when a framework...
- 155
- 414
- 0
báo cáo hóa học:" Quality of life in female myocardial infarction survivors: a comparative study with a randomly selected general female population cohort" pot
... (mean 71.4 years) at p = 0.015 Instruments Socio-demographic and clinical data Information on socio-demographic data such as age, educational level, cohabitation and marital status was obtained by ... multidimensional QOL of a reasonably sized sample of female MI survivors and that of the general female population of the same age range, as well as a thorough evaluation of the clinical importance of ... statistical software R (The R Foundation for Statistical computing, Vienna, Austria) was used for bootstrap analyses (R package boot) and permutation tests All other analyses were performed with...
- 11
- 428
- 0
Báo cáo hóa học: " Structural Analysis of Single-Point Mutations Given an RNA Sequence: A Case Study with RNAMute" potx
... CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGG A GCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU U A GGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC ... CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUC C GGGGCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ... CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGG A AGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGGU G GCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC...
- 7
- 317
- 0
Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf
... immobilization device and take approximately 30 minutes to position the patient and to acquire both the CT and PET data in total CT images were obtained at 120 kVp and variable mA (AutomA technique) with ... sTL In addition, no obvious correlation between SUVmax and C-pGTV was found and this might imply that a large tumor is not always associated with an aggressive metabolic activity within a tumor ... tumors with SUVmax < 10 or eliminating cases with C-pGTV < 20 mL, both the sTLs and the sSUVs were found to have a similar pattern of correlation with the SUVmax There was no apparent Kao et al Radiation...
- 8
- 368
- 0
Báo cáo y học: " Initial experience with a synthetic sealant PleuraSeal™ after pulmonary resections: a prospective study with retrospective case matched controls" docx
... lung sealant an intraoperative air leak test during lung inflation was carried out to evaluate the location and grade of air leaks as described above In the event of a grade air leak additional suture ... to access by standard suturing or fleece-bond sealants, PleuraSeal™ as a liquid sealant is ideal to seal air leaks in this interlobar space with its many anatomical variations As part of this Protocol ... parenchyma with warm saline and retested under pressure to confirm that all alveolar air leaks had been successfully halted with the study sealant, and in only one patient was an additional application...
- 9
- 214
- 0
báo cáo khoa học: " Patient- and delivery-level factors related to acceptance of HIV counseling and testing services among tuberculosis patients in South Africa: a qualitative study with " pdf
... Kenya Association of Professional Counsellors (KAPC) conference for sub-Saharan Africa SAHARA J 2004, 1(3):175-181 Mahendradhata Y, Andono Ahmad R, Lefèvre P, Boelart M, Van der Stuyft P: Barriers ... 2004 Daftary A, Padayatchi N, Padilla M: HIV testing and disclosure: a qualitative analysis of TB patients in South Africa Aids Care 2007, 19(4):572-577 Yawn BP: The impact of childhood asthma on ... facilities, staff, and availability of treatment and support The provision of health education to patients was most often mentioned as a facilitating factor The second most cited factor was the availability...
- 10
- 407
- 0
Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report" doc
... journal Author details Departments of Radiology, Saitama Red Cross Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan 2Department of Pathology Saitama Red Cross Hospital, 8-3-33, Kamiochiai, ... Kamiochiai, Chuo-ku, Saitama, Saitama, Japan Authors’ contributions MY conceived the study YK and RM performed the literature review AA and KK performed histopathologic and immunohistochemical analyses ... underrecognized peripheral nerve sheath neoplasm Acta Pathol Lab Med 2007, 131(4):625-636 Miyake M, Tateishi U, Maeda T, Arai Y, Seki K, Sugimura K: Computed tomography and magnetic resonance imaging findings...
- 4
- 384
- 0
Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report." pps
... journal Author details Departments of Radiology, Saitama Red Cross Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan 2Department of Pathology Saitama Red Cross Hospital, 8-3-33, Kamiochiai, ... Kamiochiai, Chuo-ku, Saitama, Saitama, Japan Authors’ contributions MY conceived the study YK and RM performed the literature review AA and KK performed histopathologic and immunohistochemical analyses ... underrecognized peripheral nerve sheath neoplasm Acta Pathol Lab Med 2007, 131(4):625-636 Miyake M, Tateishi U, Maeda T, Arai Y, Seki K, Sugimura K: Computed tomography and magnetic resonance imaging findings...
- 4
- 387
- 0
Báo cáo y học: " Binding of long-chain α-neurotoxin would stabilize the resting state of nAChR: A comparative study with α-conotoxin" docx
... (carbamylcholine) and ligand-free conformations, have recently shown that local rearrangements associated with agonist binding propagate through beta strands to the pore domain [35-37] By analogy with the AChBP ... subunits alpha2, delta and gamma, and the Floop in alpha2; but they are restricted in the C-loop of α1, F-loop in gamma, Cys loop and loop A in alpha2, and Cys and F-loop in delta (Fig 4A) It seems ... receptor, at the interfaces formed between two subunits: alpha1 with gamma, and alpha2 with delta (not shown here) The toxin lies almost equatorially to the extracellular domain of the nAChR, as previously...
- 15
- 161
- 0
Báo cáo y học: "PEEP titration guided by ventilation homogeneity: a feasibility study using electrical impedance tomography" ppt
... subtracted As a result a quasi-symmetric left and right lung area is generated that includes all detectable lung area and that excludes the cardiac-related area The maximum global dynamic compliance ... Tanaka H, Sipmann FS, Santos DC, Barbas CS, Carvalho CR, Amato MB: Imbalances in regional lung ventilation: a validation study on electrical impedance tomography Am J Respir Crit Care Med 2004, ... the manuscript critically JG gave valuable advices and contributed to writing KM contributed to study design, data analysis and writing All authors read and approved the final manuscript Acknowledgements...
- 8
- 245
- 0
Báo cáo y học: "Earthquake-related versus non-earthquake-related injuries in spinal injury patients: differentiation with multidetector computed tomography" pptx
... PACS workstation on which we obtained axial images and multiplanar reformatted sagittal and coronal images Surface-shaded display was used to evaluate the vertebral fractures and the deformation ... processes, facets, pars interarticularis, spinous process and atlantoaxial subluxation Spinal canal narrowing was measured in all injured vertebrae at the point of greatest narrowing and was defined as ... useful and (E) recovery Statistical analysis Data for each patient were entered into a Microsoft Excel database (Microsoft Corporation, Redmond, WA, USA) We performed data analysis on a personal...
- 10
- 224
- 0
báo cáo hóa học:" Cadaveric and three-dimensional computed tomography study of the morphology of the scapula with reference to reversed shoulder prosthesis" pptx
... the study and analized CT scans and cadaveric specimens and drafted the manuscript MC analized cadaveric specimens and participate in Kappa study GG analized CT scans and participate in Kappa study ... coracoid(β) axis and the base ofcraneo-caudal process axis and angle Measure4of angle between the major craneo-caudal glenoid Measure of angle between the major craneo-caudal glenoid axis and ... Journal of Orthopaedic Surgery and Research 2008, 3:49 ders and snapping scapula [11] Anatomic total shoulder replacement has also been the subject of radiological and tomographic scapular anatomic...
- 8
- 389
- 0
Báo cáo y học: "Are bone erosions detected by magnetic resonance imaging and ultrasonography true erosions? A comparison with computed tomography in rheumatoid arthritis metacarpophalangeal joints" pptx
... coronal and (f) axial planes reveal the same erosions in the 3rd and 5th metacarpal heads as marked on the CT images US at the ulnar aspect of the 5th metacarpal head, in (g) longitudinal and ... coronal and (c) axial planes of a RA patient's 2nd MCP joint T1-weighted MRIin (d) coronal and (e) axial planes US in (f) longitudinal and (g) transversal planes Anerosion (white arrows) at the base ... ultrasonographic pathology J Rheumatol 2005, 32:2485-2487 34 Alasaarela E, Suramo I, Tervonen O, Lahde S, Takalo R, Hakala M: Evaluation of humeral head erosions in rheumatoid arthritis: a comparison...
- 9
- 376
- 0
Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps
... cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage of the central and peripheral areas ... Diagnosis in 68 Cases of Solitary Pulmonary Nodule Radiation Medicine 2003, 21:267-271 20 Ohono K, Miyoshi S, Minami M, Akashi A, Maeda H, Nakagawa K, Matsumura A, Nakamura K, Matsuda H, Ohashi ... suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters were as follows: 1.0 mm collimation,...
- 5
- 657
- 0
báo cáo khoa học: "Successful treatment of a free-moving abdominal mass with radiation therapy guided by conebeam computed tomography: a case report" potx
... Cite this article as: Dabaja et al.: Successful treatment of a free-moving abdominal mass with radiation therapy guided by cone-beam computed tomography: a case report Journal of Medical Case Reports ... the patient data regarding the radiation treatment MRS analyzed the technical data, particularly use of the conebeam CT PH helped obtain consent and provided patient care KJP generated comparative ... part of vertebral body S2 Disease was evident in the mediastinum and right pleural area but was not causing any symptoms at that time, and the decision was made to administer palliative radiation...
- 4
- 375
- 0
Báo cáo y học: " Fluorodeoxyglucose-positron emission tomography/computed tomography in the staging and evaluation of treatment response in a patient with Castleman''''s disease: a case report" pps
... lymphomas to characterise metabolically undetermined masses, tumour staging and restaging, treatment response evaluation and radiotherapy treatment planning In fact, it allows a combination of ... both anatomical and biological co-registered images acquired in the same session, with a dual gain in diagnostic accuracy Staging is crucial in the identification of the appropriate treatment ... present study, PET seems to represent the most appropriate approach In fact, Castleman's disease, as with aggressive lymphomas and many solid tumours, presents an increase in glucose metabolic activity...
- 4
- 360
- 0
Báo cáo y học: " Evolution of changes in the computed tomography scans of the brain of a patient with left middle cerebral artery infarction: a case report" pps
... density changes in appearance to become isodense with brain tissue and ultimately (after at least a month) to appear as an area of low density Figure admission Computed tomography scan of the brain ... the area of infarct is seen as low density within the vascular territory involved However, an immediate CT brain scan in acute middle cerebral artery (MCA) infarction may initially appear normal ... occasionally within the basal ganglia Acute haemorrhage appears as an area of high density (white) There is often surrounding low density oedema with associated mass effect Over the subsequent to 10 days...
- 4
- 508
- 0
Báo cáo y học: "Chest computed tomography with multiplanar reformatted images for diagnosing traumatic bronchial rupture: a case repot" pot
... tracheobronchial injury [19], and suggests that alveolar barotrauma and tracheobronchial rupture might be associated in patients with severe blunt chest trauma tracheal and 76% are exclusively bronchial, ... precarious, characterized by abundant bleeding of the respiratory tract and a rapid drop of arterial oxygen saturation, all factors that precluded diagnostic confirmation Most trauma centers agree ... ventilator-associated pneumonia caused by Pseudomonas aeruginosa delayed withdrawal of the patient from mechanical ventilation, which was successfully achieved on day 18 A new CT scan was performed...
- 8
- 239
- 1
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx
... Presentation of patients 1a (N = 59) Age (years )a Male/Female (%male) Transmission of HCV Post-transfusional IVDA Sexual Hemodialysis Hemophilia Thalassemia Inmate Travel abroad Hejamate Other ... of hepatitis C virus infection among thalassemic patients in Iran Transfusion Today 2002, 53:3-4 Alavian SM, Einollahi B, Hajarizadeh B, Bakhtiari S, Nafar M, Ahrabi S: Prevalence of hepatitis ... Gholami B, Masarrat S: Hepatitis C risk factors in Iranian volunteer blood donors, a case control study J Gastroenterol Hepatol 2002, 17:1092-7 Alavian SM, Ardeshiri A, Hajarizadeh B: Seroprevalence...
- 6
- 337
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25