... Bourland, Brian Wallace, and Samir Balwani Also, thank you to Loren Feldman, Jay Izso, Brent Csutoras, Chris Winfield, Allen Stern, Anita Campbell, Laura Fitton, Muhammad Saleem, Jonathan Fields, ... Reputation Management Somewhat related to improved search engine rankings is the impact of social media on reputation management Social media can aid reputation management in many ways (and will ... the analysis of elements on a particular web page and enhances them, using available search engine algorithmic knowledge (as seen by repeated success and observation; search engines naturally...
Ngày tải lên: 29/03/2014, 10:20
... understand this idea: that the words you need to notice and pay attention to are the words you probably ignore as being too simple to learn You recognise them, but can you use them? This is a small ... important step - don't ignore familiar looking words Learn to see patterns The next step is of course to practise (note the spelling!) I will add, however, that you need to practise regularly and ... necessary because you cannot "learn" all the words as there are simple too many of them: only this week the millionth word in English was recorded! A great site for practice Flo Joe is a perfect "little...
Ngày tải lên: 05/11/2012, 09:18
TEMPORAL VARIATIONS OF POLLUTANT LOADS DURING STORM EVENTS IN A SMALL RIVER BASIN
... midstream area of Uji River and around the junction of Uji River and Niyodo River There are many pulp factories around the downstream area of Saina River, and the wastewater from the factories ... from various land cover types J Water Pollut Control Fed., 252-264 Standard Methods for Examination of Water and Wastewater (1998) 20th edition, American Public Health Association / American Water ... rate (m /s/km ) Relationships between pollutant load and flow rate Relationships between pollutant loads and runoff are examined by the following empirical equation L /A = a (Q /A) n Specific loading(g/s/km...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu ANSYS Mechanical- A Powerful Nonlinear Simulation Tool pdf
... Stamping (ANSYS LS-DYNA) and springback analysis (ANSYS Mechanical) Figure Nonlinear collapse study of a beverage can Common Features ANSYS Mechanical data input can be parametric, allowing for parametric ... the ANSYS Mechanical program’s core strengths: distributed processing, variational analysis and adaptive nonlinear analysis ANSYS, Inc will continue to develop advanced analysis features, with an ... solver such as the AMG (Algebraic Multi Grid) equation is a particular strength of the ANSYS Mechanical program Moreover, the calculation can take advantage of parallel processing in a shared memory...
Ngày tải lên: 23/12/2013, 01:16
Tài liệu HOW TO ORGANIZE AND RUN A SMALL BUSINESS ppt
... valuation approaches are based on earnings or assets Under the earnings approach, adjusted average net income may be capitalized at an appropriate multiple; with the assets approach, assets are ... Entrepreneurial Development Hearings and Appeals HUBZone Financial Assistance—Loan Programs Government Contracting SBA Programs Native American Affairs International Trade Investment Division (Small business ... Business Plans For Accuracy And Consistency Once you have written your business plan, have an accountant or financial analyst verify the accuracy of your figures and financial analyses Ask him or...
Ngày tải lên: 18/01/2014, 09:20
Tài liệu BRITISH COLUMBIA STARTING A SMALL BUSINESS OCTOBER 2011 EDITION pdf
... gateway for Asia Pacific trade, with the most competitive supply chain on the west coast of the Americas Today, Canada’s Pacific Gateway is a world-class transportation network Its integrated, seamless ... seamless supply chain includes airports, seaports, railways, roadways and border crossings, connecting Canada and the North American market to Asia and the world page 17 Major public-private investments ... Publications at 250 387-2432 You can also sign up (for a fee) for QP Legaleze, a searchable database of current provincial laws and laws that are under development (they have not yet been passed...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... mRNA level is depicted as a ratio of DAPK-1 ⁄ s-DAPK-1 to actin (E, F) s-DAPK-1, DAPK-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma ... USA), anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian ... (Covance) and antibody to Flag (Sigma) After incubation with the appropriate primary antibodies for h, cells were washed with NaCl ⁄ Pi, stained with mouse Alexa488-conjugated secondary antibody,...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: "a Computer-Aided Summarisation Tool" docx
... Donaway, Kevin W Drummey, and Laura A Mather 2000 A comparison of rankings produced by summarization evaluation measures In Proceedings of NAACL-ANLP 2000 Workshop on Text Summarisation, pages ... investigate to what extent an automatic summarisation system can help a human summariser produce high quality summaries A tool which integrates several well-known summarisation methods and which allows ... on Language Resources and Evaluation, pages 1187 — 1191, Athens, Greece, 31 May —2 June Chris D Paice 1981 The automatic generation of literature abstracts: an approach based on the identification...
Ngày tải lên: 22/02/2014, 02:20
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 ... (Amersham Pharmacia Biotech) following manufacturer’s instructions The p26 bands were scanned with a BioÁRad Model GS-670 Imaging Densitometer and analyzed in MOLECULAR ANALYST Values so obtained...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx
... cerevisiae and S pombe with one gene (Sky1 and Dsk1, respectively); Candida albicans with two (QSAA48 and QS9Q27); Aspergilus niger with nine (A2 QAE4, A2 QB94, A2 QC46, A5 AB23, A2 QWQ2, A2 QX01, A2 QX98, ... negatively affected by interaction with scaffold attachment factors B1 and FEBS J 276, 5212–5227 18 Nakagawa O, Arnold M, Nakagawa M, Hamada H, Shelton JM, Kusano H, Harris TM, Childs G, Campbell ... R, Hartmann AM, Stamm S, Georgatsou E & Giannakouros T (2001) Cloning and characterization of an alternatively spliced form of SR protein kinase that interacts specifically with scaffold attachment...
Ngày tải lên: 06/03/2014, 01:20
Legal Guide for Starting & Running a Small Business ppt
... their invaluable contributions—especially Steve Elias, Robin Leonard, Barbara Hodovan, Jackie Mancuso, Tony Mancuso, Barbara Kate Repa, Beth Laurence and Ilona Bray In addition to the folks at Nolo, ... be taxed on your personal income tax return at your marginal tax rate But with an LLC or corporation that’s taxed as a separate entity, the tax rate will almost certainly be lower You can share ... corporate rate, 15% If Sally and Randy had wanted to take home more money instead of leaving it in the business, they could have increased their salaries and paid taxes at a rate of at least 15% and...
Ngày tải lên: 06/03/2014, 09:20
Báo cáo khoa học: "a bilingual dictionary generating tool" potx
... human or a machine, expects all translations to be accurate We evaluated 2000 randomly selected Japanese entries from the initial translation candidates, scoring all Hungarian translations as correct ... bilingual dictionaries used as resources are text files, with a translation pair in each line: Table 1: Recall evaluation results (* marks a manually created dictionary) (b) 1-to-1 precision evaluation ... entries For example, with Hungarian-Japanese we considered all translation candidates whose Hungarian entry starts with “zs” (IPA: ʒ) 133 head words totalling 515 translation candidates comprise...
Ngày tải lên: 08/03/2014, 01:20
A Small-Scale Agriculture Alternative: Poultry pdf
... water available for swimming An old water heater tank cut in half works well Specialty Poultry Many unique markets exist Quail, pheasants, turkeys, and guinea fowl are raised for meat markets ... markets Some birds are raised for exhibition Mallard ducks, quail, and pheasant are raised for hunting preserves and for dog training Markets are also available for racing pigeons, feathers for fly ... operations can serve as a catalyst for virus mutation and increase the risk for disease outbreaks. A feather or one speck of fecal matter can carry billions of infectious germs Avoid unnecessary...
Ngày tải lên: 08/03/2014, 09:20
Guide on How to Develop a Small Hydropower Plant pot
... semi-Kaplan siphon Radial Siphon Parallel 6.16 Inclined semi-Kaplan siphon Axial Siphon Parallel 6.17 Kaplan S Axial Gate valve Parallel 6.18 Kaplan inclined right angle Axial Gate valve Conical ... Relevant operational data of the plant should be collected and made readily available for making operating decisions, and stored in a database for later evaluation of plant performance c) An intelligent ... Semi-Kaplan in pit Axial Gate valve Parallel 6.20 165 Guide on How to Develop a Small Hydropower Plant ESHA 2004 gate Trashrack inclined semi-Kaplan siphon Vertical Kaplan or semi-Kaplan Figure...
Ngày tải lên: 08/03/2014, 13:20
Báo cáo khoa học: FH8 – a small EF-hand protein from Fasciola hepatica docx
... & Carmona C (1997) Proteinases secreted by Fasciola hepatica degrade extracellular matrix and basement membrane components J Parasitol 83, 1–5 Maizels RM & Yazdanbakhsh M (2003) Immune regulation ... pathogen, Fasciola hepatica: proteins associated with invasion and infection of the mammalian host Mol Cell Proteomics 8, 1891–1897 Silva E, Castro A, Lopes A, Rodrigues A, Dias C, Conceicao A, ... A, Alonso J, Costa JMC, Bastos M, Parra F ¸ ˜ et al (2004) A recombinant antigen recognized by Fasciola hepatica-infected hosts J Parasitol 90, 746–751 Ram D, Grossman Z, Markovics A, Avivi A, ...
Ngày tải lên: 15/03/2014, 00:20
Writing a Business Plan: An Example for a Small Premium Winery potx
... coordinating winery operation and Manager maintenance, sales, marketing, financial record keeping, and staffing General Manager Coordinate winery operation and maintenance, sales, marketing financial ... experiences and January recommendations for a lawyer (3) Send to BATF and SLA for application packets January (4) Hire a lawyer to help with the application process February (5) Have all forms and paperwork ... Management January/February 1999 Barclay, Veronica “Are You Marketing to the Affluent.” Vineyard and Winery Management January/February 2000 Bizplanit www.bizplanit.com Bureau of Labor and Statistics...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator for the syntactic task ... state-of-the-art to generate paraphrases Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Annual Meeting of ACL, pages 597–604, Morristown, NJ, USA Association ... because a statistical paraphrase table, an analogical solver and a paraphrase memory for instance; there is no constraint on the scoring function because it only scores final states Note that...
Ngày tải lên: 17/03/2014, 02:20
Setting up and running a small-scale dairy processing business potx
... Lusaka, Zambia Maryline Simba, Simba Foods, PO Box 79360, Ubungo-Maziwa, Dar es Salaam, Tanzania Masoud Rizvi Fidahussein & Co., Vingunguti Industrial Area, PO Box 816, Dar es Salaam, Tanzania ... others: Alfred Malijani, PO Box 320245, Lusaka, Zambia Anna J.H Temu, Power Foods, opposite Kawa Tanganyika Packers, PO Box 23437, Dar es Salaam, Tanzania Charlotte Ayayee, Joecarl Enterprise ... Lusaka, Zambia Claudia Mary Massawe, Clama Quality Product, PO Box 33496, Dar es Salaam, Tanzania M.T Kaputo, Food Technology Research Unit, National Institute for Scientific and Industrial Research,...
Ngày tải lên: 18/03/2014, 00:20
art deco studio concept basic concept for interior design ideas in a small space
Ngày tải lên: 21/03/2014, 21:56
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... was incubated with amylin to evaluate its effect on amylin aggregation Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scattering assays and HPLC analysis ... trifluoroacetic acid Absorbance was measured at 280 nm, and the flow rate was 0.3 mL ⁄ Statistical analysis Data from three independent experimental groups are presented as mean values ± standard deviation ... believed that insulin serves as an important biological factor that inhibits amylin aggregation [10,11] Early studies claimed that insulin might act as a natural inhibitor under normal circumstances...
Ngày tải lên: 23/03/2014, 04:21