a connector between the developing vascular and neuronal system
Báo cáo y học: " Mechanical ventilation in the ICU- is there a gap between the time available and time used for nurse-led weaning?" pot
Ngày tải lên :
13/08/2014, 23:20
... physician) was analysed as a systemic factor Ethical considerations We collected data from the ICU quality assurance database as well as ICU patient charts The Norwegian Social Science Data Services ... and systemic factors associated with the time available for weaning that was actually Table 2: The relationship between weaning prescribed and weaning being performed in the 572 available weaning ... collection and was the primary author of the manuscript WMF created the File Maker Pro database used to store our data, was in charge of the data collection, and contributed to authoring the manuscript...
- 8
- 338
- 0
THE EFFECT OF EARNING, WORKING ENVIRONMENT, AND PROMOTION OPPORTUNITIES ON EMPLOYEES’ PERFORMANCE A COMPARISON BETWEEN THE STATE SECTOR AND OTHER SECTORS IN VIETNAM
Ngày tải lên :
01/06/2015, 20:09
... analyzing the data and make the data analyzing: 1- Testing reliability of scales by using Cronbach’s Alpha and Coefficient: This was tested the Cronbach’s Alpha of each scale of each factor as well as ... can remove inappropriate variables and limit junk variables in the research process and assess the reliability of the scale through the Cronbach Alpha coefficient Which variables have correlation ... testing reliability and Exploratory Factor Analysis (EFA) above independent variable that include Earning, Working Environment, and Promotion Opportunities are acceptable and have practical value 4.3.3...
- 65
- 540
- 1
The effect of earnings, working environment and promotion activities on employees performance a comparison between the state sector and other sectors in viet nam
Ngày tải lên :
06/04/2016, 18:01
... analyzing the data and make the data analyzing: 1- Testing reliability of scales by using Cronbach’s Alpha and Coefficient: This was tested the Cronbach’s Alpha of each scale of each factor as well as ... can remove inappropriate variables and limit junk variables in the research process and assess the reliability of the scale through the Cronbach Alpha coefficient Which variables have correlation ... testing reliability and Exploratory Factor Analysis (EFA) above independent variable that include Earning, Working Environment, and Promotion Opportunities are acceptable and have practical value 4.3.3...
- 62
- 569
- 0
A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school
Ngày tải lên :
07/11/2012, 14:44
... skills they are good at or bad at (Question 2), nearly all of them answer that they are good at writing and reading since they like and usually practice these skills; in contrary, they are bad at ... manager of the class The teacher can teach anything they find necessary and students are only the listeners Students have to what their teacher tells them Teacher can ask students questions and ... more accurate data, both quantitative and qualitative methods were used Quantitative data were gathered through two survey questionnaires administered both 14 to the students and the teachers and...
- 44
- 841
- 0
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
Ngày tải lên :
09/03/2014, 01:20
... hierarchy for concept generalization Atomic f o r m u l a i n FTABLE and THESAURUS Knowledge Base consists of LEXICON, THESAURUS and FTABLE The case grammar, as a basis of internal representation, ... the special combination of concepts like WAR with DISASTAR They play a role to match syntagmatic relation with semantics in terms of syntax These two processes analize the pragmatic, modal, and ... binary relation The semantics in the sense used here may not necessarily be shared among languages, while facts are shared among languages Legato built on the model is syntactic and semantic analysis...
- 7
- 373
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
Ngày tải lên :
20/06/2014, 01:20
... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4 ... from database, performed the sequences analysis and critically revised the manuscript 14 16 18 19 Acknowledgements We are grateful to Natalia Gudiño for the language corrections of the manuscript,...
- 4
- 329
- 0
Intestinal Fish Parasites as Heavy Metal Bioindicators: A Comparison Between Acanthocephalus lucii (Palaeacanthocephala) and the Zebra Mussel, Dreissena polymorpha pot
Ngày tải lên :
28/07/2014, 17:21
... thus also recorded between the size and weight of perch and the cadmium 18 content of the parasites An association between the infrapopulation biomass of A lucii and the cadmium burden of the ... Paratenuisentis ambiguus (Acanthocephala), Anguillicola crassus (Nematodes) and their host Anguilla anguilla Dis Aquat Org 19: 105-107 Sures B, Taraschewski H, Rokicki, J (in press a) Lead and ... organs of the fish and the parasites 16 Figure Lead (a) and cadmium (b) concentrations in muscle, liver and intestine of perch, its intestinal parasite Acanthocephalus lucii and in the zebra mussel...
- 8
- 398
- 0
Báo cáo sinh học: "A balancing act between the X chromosome and the autosomes" ppsx
Ngày tải lên :
06/08/2014, 18:21
... (in the region that has three copies in Dp/+ flies and one in Df/+ flies) female soma and gonads; that is, the expression ratios between X chromosomes and autosomes of XX;AA female soma and X;AA ... (X;AA) but also XX;AA ovaries and X;AA sex-transformed ovaries all centered on (Figure 1) Having validated their approach, Gupta et al [8] compared expression of the X chromosome with that of the ... male soma and germline, C elegans male soma, and mammalian male soma is upregulated (dark blue, up-arrow) In Drosophila female soma, the X chromosomes are both expressed and thus not upregulated...
- 3
- 315
- 0
Báo cáo toán học: "A Relationship Between the Major Index For Tableaux and the Charge Statistic For Permutations" pptx
Ngày tải lên :
07/08/2014, 13:21
... now give details that the charge statistic and the inversion statistic not only have the same generating function on Sn , but they in fact have the same generating function on Wλ Lemma For λ = ... and D Jackson, Combinatorial Enumeration, Dover Publications, 2004 [5] K Killpatrick, A Combinatorial Proof of a Recursion for the q-Kostka Polynomials, Journal of Combinatorial Theory, Ser A ... [2] S Cho, Major Index for Standard Young Tableaux, ARS Combinatoria 71 (2004) pp 93-99 [3] D Foata and M Sch¨ tzenberger, Major index and inversion number of permutau tions, Math Nachr 83 (1978)...
- 9
- 276
- 0
Báo cáo sinh học: "A comparison between the β-globin gene clusters of domestic sheep (Ovis aries) and Sardinian mouflon" docx
Ngày tải lên :
09/08/2014, 18:22
... sheep and goats: a possible explanation for its function and biosynthesis Pediatr Res 3, 189-198 Manca L, Di Luccia A, Pieragostini E, Naitana S, Masala B (1993) Haemoglobin I: a new #-globin chain ... triplicated haplotype) are characterized by fragments of 9.0, 5.5, and 6.6 kb containing the E pair genes of the juvenile, adult, and fetal sets, respectively (Rando et al, 1989) On the other hand, ... INTRODUCTION The domestic sheep (Ovis aries) #-globin gene cluster shows two common haploA types: the A haplotype bearing the adult HBB allele and the B haplotype bearing the adult HBB allele (Garner and...
- 6
- 316
- 0
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx
Ngày tải lên :
13/08/2014, 09:20
... ggaaaatctctagcagtggtagcagaggatggttctgaaagcgaaagggaaac 3' Met(i) 5' gtttccctttcgctttcagaaccatcctctgctaccactgctagagattttcc 3' 5' ggaaaatctctagcagtggtagcagagggtggttctgaaagcgaaagggaaac 3' Met(i) AG ... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and ... tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg acctctgggttatgggcccagcacgcttccgctgcgccactctgct...
- 14
- 189
- 0
Báo cáo y học: "Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network classifications" potx
Ngày tải lên :
13/08/2014, 11:22
... guidelines Statistical analysis Continuous variables are expressed as the mean ± standard deviation, and categorical variables are presented as the percentage of the number of cases Comparisons between ... data, and the analysis and interpretation of data JAL, ZCeS, CF and MMP were involved in drafting the manuscript and revising it critically for important intellectual content All authors gave final ... C, Carmo JA, Lacerda JF, Prata MM: An assessment of the RIFLE criteria for acute renal failure following myeloablative autologous and allogeneic haematopoietic cell transplantation Bone Marrow...
- 8
- 419
- 0
minority shareholders protection in shareholding companies a comparison between vietnamese enterprises law and the united kingdom company law
Ngày tải lên :
18/08/2014, 12:34
... the shareholders and the board Any transaction between a company with any of the parties below is a related party transaction and must be approved at a general meeting or by the board211 • Majority ... treatment as the majority As the weaker party in a company, minority shareholders only need an equitable and fair treatment protecting their rights as provided by law and the capital they have invested ... more, or holding a smaller percentage as stipulated in the charter of the company, has the right to nominate candidates to the Board of Management and the Supervisory Board142 and the voting to...
- 60
- 404
- 1
Tài liệu Mapping Table and Column Names Between the Data Source and DataSet docx
Ngày tải lên :
14/12/2013, 18:16
... tables within a DataSet, the table names default to Table, Table1, Table2, and so on You can use table mapping to rename tables created within the DataSet to match the table names in the data ... fill a DataSet, the column names used in the DataSet default to the column names defined in the data source A DataAdapter has a collection of DataTableMapping objects in its DataTableMappingCollection ... Create the table mapping to map the default table name 'Table' DataTableMapping dtm = da.TableMappings.Add("Table", "tblmapCategories"); // Create the column mappings for the Categories table...
- 3
- 445
- 0
Tài liệu Capitalize this- a guide to the proper care and feeding of capital letters doc
Ngày tải lên :
20/12/2013, 18:15
... geologists call this material “garbage”) is often deposited in formations called morains Capitalize the personal pronoun I A CAPITAL IDEA! The Uses and Rules of Capital Letters Capitalize the names ... names of family relations when they are used as substitutes for names: I went to visit my Uncle Ted and Aunt Margaret Grandma and Grandpa live with Dad and Mom now I went with my mom and dad to visit ... don’t capitalize articles, prepositions, and coordinating conjunctions In the Lake of the Woods War and Peace I Know This Much Is True A CAPITAL IDEA! The Uses and Rules of Capital Letters Capitalize...
- 13
- 658
- 1
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
Ngày tải lên :
16/02/2014, 14:20
... timescale between the free and the bound forms for NarJT These results and the higher excess partial molar heat capacity of the complex observed by DSC are in agreement with a conformational change ... Structural basis for peptide recognition by NarJ S Zakian et al Upon peptide binding, NarJ undergoes a conformational change A The temperature dependence of the partial molar heat capacity of free NarJ ... investigate the kinetic parameters of the interaction (on rate constant kon and off rate constant koff) between NarJ and the NarG(1–15) peptide Taking into account the existence of two subpopulations...
- 10
- 685
- 0
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
Ngày tải lên :
17/02/2014, 22:20
... consumers, and why the candid among them acknowledge that these evils arise from its use? The health of the medical gentleman above named was materially improved after laying aside tobacco; and those ... rum, as an antidote against a damp atmosphere Another, to prevent the accumulation of water or bile in his stomach; and a third, as a security against the encroachment of contagious diseases ... time wasted, as are annually squandered in the various departments of raising, preparing, and consuming this plant; and to point out, if they can, in what manner a poison so deadly acts on A Dissertation...
- 29
- 586
- 0
Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt
Ngày tải lên :
19/02/2014, 09:20
... be the manager of the AIF in case of excessive delegation They are designed to specify the content and format of the annual report that AIFM have to make available for each AIF they manage and ... that, for each AIF that it manages, a valuator is appointed which is independent of the AIFM to establish the value of assets acquired by the AIF and the value of the shares and units of the AIF ... in Article 49(3) Chapter IV Transparency requirements Article 19 Annual report An AIFM shall, for each of the AIF it manages, make available an annual report for each financial year The annual...
- 54
- 755
- 0
A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States ppt
Ngày tải lên :
05/03/2014, 10:20
... of the neonate and the intestinal flora Acta Paediatrica Scandinavica 351(Suppl.):122–125 Pisacane A, Graziano L, Zona G, Dolezalova H, Cafiero M, Coppola A, Scarpellino B, Ummarino M, Mazzarella ... IgA antibodies may neutralize viruses, bacteria, or their toxins and are capable of activating the alternate complement pathway 55 The normal flora of the intestinal tract of the breastfed infant, ... children and families by leading a national effort to collect, develop, and disseminate information and educational materials on maternal and child health, and by collaborating with public agencies,...
- 40
- 816
- 1