a conceptual indexing approach based on document content representation
Báo cáo khoa học: "An Integrated Multi-document Summarization Approach based on Word Hierarchical Representation" pot
... hierarchical summarization approach for automatic multi- document summarization. By creating a hierarchical representation of the words in the input document set, the proposed approach is able ... the ACL-IJCNLP 2009 Conference Short Papers, pages 113–116,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLPAn Integrated Multi -document Summarization Approach based on Word Hierarchical ... multi -document summarization. 2 Word Hierarchical Representation 2.1 Candidate Word Identification As a matter of fact, the concepts in the original document set are not all necessary to...
- 4
- 235
- 0
Báo cáo hóa học: " Research Article A Skin Detection Approach Based on Color Distance Map" doc
... NY, USA, October 2004.[23] F. Tarr´es and A. Rama, “GTAV Face Database,” http://gps-tsc.upc.es/GTAV/ResearchAreas/UPCFaceDatabase/GTAV-FaceDatabase.htm[24] A. K. Bera and C. M. Jarque, ... 1–8, San Jose, Calif, USA, January2006.[10] M H. Yang and N. Ahuja, “Gaussian mixture model forhumanskincoloranditsapplicationsinimageandvideodatabases,” in Storage and Retrieval for Image and ... N. Bourbakis, P. Kakumanu, S. Makrogiannis, R. Bryll,and S. Panchanathan, “Neural network approach for imagechromatic adaptation for skin color detection,” InternationalJournalofNeuralSystems,...
- 10
- 227
- 0
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires
... LettersOne-dimensional organic nanostructures: A novel approach based on theselective adsorption of organic molecules on silicon nanowiresEric Salomon*, Antoine KahnDepartment of Electrical ... Sahaf, L. Masson, C. Leandri, B. Auffray, G. Le Lay, F. Ronci, Appl. Phys. Lett.90 (2007) 263110.[3] M .A. Valbuena, J. Avila, M.E. Davila, C. Leandri, B. Aufray, G. Le Lay, M.C.Asensio, Appl. ... the nanowires. In the latter case, chemisorption of suitable organic molecules on thenanowires leads to a well-defined one-dimensional aggregation and changes the metallic character ofthe nanowires...
- 5
- 465
- 0
Báo cáo khoa học: "Multilingual Document Clustering: an Heuristic Approach Based on Cognate Named Entities" docx
... this approach we emphasize the feature selec-tion based on NEs identification and the grammat-ical category of the words. The selection of fea-tures we applied is based on previous work (Casil-las ... identification. One of the main ad-vantages of this approach is that it does not depend on multilingual resources such as dictionaries, ma-chine translation systems, thesaurus or gazetteers.The only ... 1-10.Arantza Casillas, M. Teresa Gonz´alez de Lena andRaquel Mart´ınez. 2004. “Sampling and FeatureSelection in a Genetic Algorithm for Document Clustering”. Computational Linguistics and...
- 8
- 421
- 0
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx
... Shaw, based in Dalton, Ga., has an- nual sales of about $1.18 billion, and has economies of scale and lower raw-material costs that are ex- pected to boost the profitability of Armstrong's ... section 23 using model (3). For 'no lexi- cal information' all estimates are based on POS tags alone. For 'no distance measure' the distance mea- sure is Question 1 alone ... Sleator and, D. Temperley. 1992. Grammatical Trigrams: A Probabilistic Model of Link Grammar. Proceedings of the 1992 AAAI Fall Symposium on Probabilistic Approaches to Natural Language....
- 8
- 320
- 0
Báo cáo khoa học: "Reordering Constraint Based on Document-Level Context" potx
... Association for Computational LinguisticsReordering Constraint Based on Document- Level ContextTakashi Onishi and Masao Utiyama and Eiichiro SumitaMultilingual Translation Laboratory, MASTAR ... Workshop on Statistical Machine Translation andMetricsMATR, pages 418–427.Deyi Xiong, Min Zhang, and Haizhou Li. 2010. Learn-ing Translation Boundaries for Phrase -Based Decod-ing. In Human Language ... points in Japanese-English translation and1.41% BLEU points in English-Japanese translation.2 Patent TranslationPatent translation is difficult because of the amountof new phrases and long sentences....
- 5
- 234
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CTCACCACAGACGATWTCCPLA5G2 (F) CGGTAAGCCCATAACGCCCAPLA3G2 (R) CAGGCCAGGATTTGCAGCCPLA3G4 (R) CATAAACAYGAGCCAGTTGCCARTF a (F) GAGTGGATGCACAGTCGTTGARTR a (R) GAAACGGAGGTAGTGACACATAtxBFb(F) GCCTGCTCGAATTCGGGATGAtxBrcb(R) ... GCCTGCTCGAATTCGGGATGAtxBrcb(R) CTCCTTCTTGCACAAAAAGTGAtxACFc(F) CTGCTCGAATTCGGGATGAtxACrcc(R) GTCYGGGTAATTCCTATATAAmlFd(F) GTGATCGAATTTGGGAAGATGATCCAAmlrcd(R) CCCTTGCATTTAAACCTCAGGTACAC a Specific ... (F)CCCTATAGTGAGTCGTATTAT7 Promoter (R) CAGGAAACAGCTATGACPLA5G (F) CGGAATTCTGAAGGTGGCCCGCCAGGTGACAGPLA3G (R) CGCGGATCCAATCTTGATGGGGCAGCCGGAGAGGPLA5G1 (F) AGGAYTCTCTGGATAGTGGPLA3G1 (R) CTCACCACAGACGATWTCCPLA5G2...
- 10
- 451
- 0
Measurement, Monitoring, and Forecasting of Consumer Credit Default Risk – An Indicator Approach Based on Individual Payment Histories doc
... fact that the emphasislays on once-only sales on credit which have to be paid until a certain payment deadline.In addition, the analysis of accounts receivable aims for an appropriate estimation ... able to make a qualitativedecision on the performance of the loan, for example for newly acquired accounts oraccounts that are delinquent for 30 days.An alternative approach to arrive at a ... receivable andpayable. In: Altman, Edward I. (ed.): Handbook of corporate finance. Wiley, New York.Kallberg, Jarl G. and Saunders, Anthony (1983): Markov chain approaches to the analysisof payment...
- 29
- 365
- 0
Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classification" docx
... rich feature space. RSToffers a formal framework for hierarchicaltext organization with strong applicationsin discourse analysis and text generation.We demonstrate automated annotation of a text ... fully annotated in a matterof minutes. This opens the way to manynovel applications in real-time natural languageprocessing and generation, such as the RST -based transformation of monological ... EDUsEDUsLexicalized Syntax TreesSyntax Parsing (Charniak's nlparse)Syntax TreesLexicalizationLexicalizationLexicalized Syntax TreesSyntax TreesAlignmentFeature Extraction AlignmentFeature...
- 9
- 390
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... CareInternational.Mouse adaptationThe general approach to adapt MARV to mice was based on virus passage in scid (BALB/c background) mice toavoid usage of suckling mice to develop a lethal mouse-adapted ... National ResearchCouncil, 1996. The facility where this research was con-ducted is fully accredited by the Association for Assess-ment and Accreditation of Laboratory Animal CareInternational.Mouse ... cells of thezona fasciculata and zona reticularis at days 6 and 8.Use of the 'scid-adapted' MARV model to assess the efficacy of potential therapeutics for MARVTo demonstrate the utility...
- 13
- 456
- 0
Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf
... manuscriptwriting; EA participated to study design, data collection and analysis, andmanuscript definition; PR participated at data collection; EG participated atdata collection; FM participated to recruitment ... effects on cycling and walking ability in chronicstroke patients. A case series study was designed and participants were recruited based on a gait patternclassification of a population of 153 chronic ... couldreally have an impact also as a home-rehabilitationtreatment for chronic stroke patients.AbbreviationsANOVA: analysis of variance; BF: biofeedback; EMG: electromyography; VOL1:first phase of...
- 13
- 443
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... CareInternational.Mouse adaptationThe general approach to adapt MARV to mice was based on virus passage in scid (BALB/c background) mice toavoid usage of suckling mice to develop a lethal ... Laboratory Animals, National ResearchCouncil, 1996. The facility where this research was con-ducted is fully accredited by the Association for Assess-ment and Accreditation of Laboratory Animal ... cells of thezona fasciculata and zona reticularis at days 6 and 8.Use of the 'scid-adapted' MARV model to assess the efficacy of potential therapeutics for MARVTo demonstrate the utility...
- 13
- 431
- 0
Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx
... solutionto navigation in GPS signal degraded areas?. Geomatica. 59(2), 175–182(2005)6. M Kourogi, T Ishikawa, Y Kameda, J Ishikawa, K Aoki, T Kurata, Pedestriandead reckoning and its applications, ... layout map matrix adequate forour simulation environment. The walls are depicted inblack, not easily reachable forest area is marked withdark gray, and flowerbed areas are drawn in light gray.Theareawherepeoplemaywalkisdrawninwhite.Inaddition, ... Novel approach to nonlinear and non-Gaussian Bayesian state estimation. Proc Inst Elect Eng. 140, 107–113 (1993)31. GK Schmidt, K Azam, Mobile robot path planning and execution based on a diffusion...
- 14
- 488
- 0
Báo cáo hóa học: "Research Article A Color Topographic Map Based on the Dichromatic Reflectance Model" doc
... (http://www.cs.washington.edu/research/imagedatabase/groundtruth/tars.for.download) databases (Arborgreens,Australia, and Cambridge). They are as representative aspossible of the images generally processed ... International Conference on Image Processing(ICIP ’00), vol. 2, pp. 112–115, Vancouver, BC, Canada, Sep-tember 2000.[6] P. Monasse and F. Guichard, “Fast computation of a contrast-invariant image ... InternationalConference on Robotics and Automation (ICRA ’06), pp. 3411–3416, Orlando, Fla, USA, May 2006.[19] G. D. Finlayson and G. Schaefer, “Solving for colour constancyusing a constrained...
- 14
- 343
- 0
Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx
... computationalcomplexity,” IEEE Transactions on Broadcasting, vol. 52, no. 1,pp. 83–86, 2006.[14] A. D. S. Jayalath and C. Tellambura, “Adaptive PTS approach for reduce of peak-to-average power ratio ... stopcriteriaDecisiontakenUpdate the personal andglobal best positionaccording to the fitness valueUpdate each particlesvelocity and positionAdjust inertial weightmonotonicallydecreasing functionEndYe ... Shi and R. Eberhart, A modified particle swarm opti-mizer,” in Proceedings of the IEEE International Conference on Evolutionary Computation (ICEC ’98), pp. 69–73, Anchorage,Alaska, USA, May...
- 8
- 406
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25