a concept shift for robotics developmental psychology and brain sciences

... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... drawer may prohibit presentment for acceptance He may al so stipulate that presentment for acceptance 75 shall not take place before a named date Unless the drawer has prohibited acceptance, every ... Exchange CHAPTER I - Issue and Form of a Bill of Exchange Article Article Article Article Article Article Article Article Article Article 10 CHAPTER II - Endorsement Article 11 Article 12 Article...

Ngày tải lên: 22/10/2013, 10:15

... which all of the ®rms of that society are organized and interconnected All capitalist societies will have state apparatuses and private ®rms, and among private ®rms some will be small and some large ... consciousness and class formation, but rather as a framework for de®ning an agenda of problems for empirical research within class analysis In the multivariate empirical studies of class consciousness and ... working-class or capitalist-class interests Limitation, selection and transformation In elaborating a micro-model of class consciousness and a macro-model of class formation we will describe the causal...

Ngày tải lên: 01/11/2013, 07:20

... Miroslav Melichar, and Martin Rajman 2005 A Framework for Rapid Multimodal Application Design In V´ clav Matouˇek, Pavel Mautner, a s and Tom´ s Pavelka, editors, Proceedings of the 8th a International ... environment and experimental protocol) has now reached a stable stage that allows for the elicitation of sufficient amounts of natural language and interaction data The next step will be to run a large-scale ... graphical, textual and vocal feedback tions compared to others, language use must be encouraged without being forced, and finding this balance can be very hard to achieve in practice Design and...

Ngày tải lên: 20/02/2014, 12:20

... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... 2007 The Authors Journal compilation ª 2007 FEBS N Zaidi et al Parallel detection of CatE and CatD activity TAPA and specific catalytic activities of CatE and CatD were determined fluorimetrically ... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates for the rapid and sensitive...

Ngày tải lên: 07/03/2014, 09:20

... Collect a water sample for bacterial analysis Standards s Know when to take a sample for bacteriological analysis and understand the importance of sample timing The current standards for judging ... Spas and hot tubs have greater water balancing demands than larger pools because of higher water temperatures and bather loads Under-saturated water is aggressive and has corrosive action against ... management and pesticide handling information for persons managing bacteria, fungi, algae or viruses in swimming pools, hot tubs, and spas and wading pools This manual is self-teaching and contains learning...

Ngày tải lên: 11/03/2014, 17:20

... morphological attribute (i.e., case) The variables L3,6 , CASE3,acc and CASE6,acc are bolded, indicating that w3 and w6 are linked and both have the accusative case The ternary factor CASE-LINK, that connects ... morphologi- cal attributes such as “plural” or “past tense” Cohen and Smith (2007) separately train a discriminative conditional random field (CRF) for segmentation and tagging, and a generative probabilistic ... scenario, where an accusative adjective was tagged as nominative, and was then misanalyzed by the parser as modifying a verb (as a subject) rather than modifying an accusative noun For participles...

Ngày tải lên: 17/03/2014, 00:20

... this paper, we describe a bilingual concordance designed as a computer assisted translation and language learning tool Currently, TotalRecall uses Sinorama Magazine corpus as the translation ... and Ministry of Education, Taiwan (NSC 90-2411-H-007-033MC and MOE EX-91-E-FA06-4-4) and a special grant for preparing the Sinorama Corpus for distribution by the Association for Computational ... database with newer information from Sinorama magazine so that the concordance is kept current and relevant to the To make these up to date and relevant The bilingual texts that go into TotalRecall...

Ngày tải lên: 17/03/2014, 06:20

... Special Operations Command, and U.S Coast Guard; and civil law enforcement less-lethal weapons A glossary is presented in appendix B Typically, DoD uses the term “nonlethal” and NIJ and civil law ... scenarios and for selected military operations in urban terrain Expandable Baton Manufacturer: Monadnock Vendor: Aardvark Tactical, Inc Approximate Cost: $73.25 Participating Services: Marines Description: ... with antiscratch and antifog coating) Participating Services: Army, Marines, Navy, Air Force, Coast Guard Description: Paulson riot face shields are manufactured from high-quality Lexan plastic...

Ngày tải lên: 23/03/2014, 23:20

... young and old, for lasting and measurable change in gender-related attitudes and behaviors Originally designed in Uganda in 1995, and now expanded beyond Africa to Asia, Latin America and the Caribbean, ... Population Council, March 3, 2009); and personal communication with A Erulkar, August 31, 2010 22 Charlotte Feldman-Jacobs and Sarah Ryniak et al., Abandoning Female Genital Mutilation/Cutting: An ... Encouraged by their example, thousands of communities in Senegal and nine other African countries (Burkina Faso, Djibouti, The Gambia, Guinea, Guinea Bissau, Mali, Mauritania, Somalia, and Sudan)...

Ngày tải lên: 28/03/2014, 14:20

... Technology, and Gianni Zappalà and Lisa Waldron from the Westpac Foundation for their encouragement and for providing an opportunity for Jenny and Rhyall to present a draft version at the joint QUT and ... social accounting, but what is it? and how can it be applied to community organisations and enterprises? Unfortunately, not a lot of information is readily-available on social accounting in the Australian ... tools that “get at” the most important information (i.e information that relates to values, aims and objectives) design tools that are easy to use and collate design tools that are appropriate to...

Ngày tải lên: 29/03/2014, 20:20

... Combinatory Categorial Grammar In Proceedings of EMNLP-2006 Mark Steedman and Jason Baldridge To Appear Combinatory Categorial Grammar In Borsley and Börjars (Borsley and Börjars, To Appear) Mark ... Johan van Benthem and Alice ter Meulen, editors, Handbook of Logic and Language, pages 93–177 North Holland, Amsterdam Richard T Oehrle To Appear Multi-Modal Type Logical Grammar In Boersley and ... Linguistics and Philosophy, 24:1–44 Avery D Andrews and Christopher D Manning 1999 Complex Predicates and Information Spreading in LFG CSLI Publications, Palo Alto, California Jason Baldridge and Geert-Jan...

Ngày tải lên: 31/03/2014, 00:20

... inequalities Carpathian J Math 24, 139–148 (2008) He, BS, Yang, ZH, Yuan, XM: An approximate proximal-extragradient type method for monotone variational inequalities J Math Anal Appl 300, 362–374 ... nonlinear variational problems Springer, New York (1984) Iusem, AN: An iterative algorithm for the variational inequality problem Comput Appl Math 13, 103–114 (1994) Yao, JC: Variational inequalities ... contributions All authors participated in the design of the study and performed the converegnce analysis All authors read and approved the final manuscript Competing interests The authors declare that they...

Ngày tải lên: 20/06/2014, 22:20

... Nanoscale Res Lett (2007) 2:202–206 203 algorithm for computing distance matrix of these nanotubes Throughout this paper, our notation is standard They are appearing as in the same way as in ... that n is even and |V(T)| = mn (1 ,1 ) ,2 (b) B ase An algorithm for constructing distance matrix of TUHC6[m,n] We first choose a base vertex b from the 2-dimensional lattice of T and assume that ... bi,j–1+1 For computing distance matrix of this nanotube we must a ðbÞ compute matrices DmÂn ¼ ½da Š and DmÂn ¼ ½db Š: But by i;j i;j our calculations, we can see that da i;j & ¼ db ¼ i;j Maxfai;j...

Ngày tải lên: 22/06/2014, 18:20

... Kennen, Advantages and Disadvantages of ADR - Understanding Alternative Dispute Resolution (2008), available at http://www.suite101.com/content/advantages -and- disadvantages-of-adr -a5 8925 Garry ... enforcement of an international arbitral award is far easier and more certain than that of a foreign court judgment41 In brief, arbitration guarantees its parties to reach a final and binding award, ... neutral and adjustable to be more appropriate for each kind of dispute Those advantages can hardly found in litigation at court ENFORCEMENT OF ARBITRAL AWARD Another significant advantage of arbitration...

Ngày tải lên: 23/06/2014, 09:15

... Vietnam 29 (2004) 149–162 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, ... Transform, MC Gray Hill, NewYork, 1951 19 H M Srivastava and Vu Kim Tuan, A new convolution theorem for the Stieltjes transform and its application to a class of singular equations, Arch Math ... Yakubovich and Yu F Lucko, The Hypergeometric Approach to Integral Transforms and Convolutions, Kluwer Acad Publ., 1994 26 S B Yakubovich and A I Mosinski, Integral equation and convolutions for transforms...

Ngày tải lên: 06/08/2014, 05:20

... editors for tagging and annotations are integrated into Galaxy’s analysis workspace and are designed to support web-based genomic research Galaxy tags are hierarchical and can have values, and these ... computational analyses, systematically repeating analyses, capturing all details of performed analyses, and annotating analyses Using Galaxy Pages, researchers can communicate all components of an ... system, and Galaxy automatically manages database and dependency updates A Galaxy instance can utilize compute clusters for running jobs, and can be easily interfaced with portable batch system...

Ngày tải lên: 09/08/2014, 20:22

... to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed by restriction endonuclease digestion and religation ... by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there ... (data not shown) In each assay we performed at least six different reactions for each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across...

Ngày tải lên: 11/08/2014, 08:20

... Materials and methods Gene datasets TCGA Data were obtained from The Cancer Genome Atlas (TCGA) database This dataset comprises of molecular characterizations from 373 GBM patients For each patient, ... mediated by p38-gamma and p38-delta pathway Celebrex COX2 Signaling mediated by p38-alpha and p38-beta pathway Cis Retinoic Acid RARA Map kinase inactivation of smrt co-repressor Sorafenib RAF1 ... tumor and its matched normal sample across all patients Table 2: Glioblastoma drug targets Drug name Target Pathway Accutane RARA Map kinase inactivation of smrt co-repressor CCNU STMN4 Signaling...

Ngày tải lên: 11/08/2014, 12:21

... normative database and standard analysis Table 2: Quick reference simplified set of normative data for electric activity obtained by surface EMG for masseter and submental group + platisma during ... dysphagia and odynophagia Each of these stages can be impaired and the screening evaluation should be capable to indicate the impaired stage Surface SEMG recording cannot trace oesophageal activity ... of a swallow The staging of normal deglutition can be clinically important as an additional tool for establishing aetiology and localization – oral, pharyngeal, or oesophageal – of causes for...

Ngày tải lên: 11/08/2014, 20:20

... intermittent asthma, each with mild persistent and moderate persistent asthma, and with severe persistent asthma No patient had Page of (page number not for citation purposes) Clinical and Molecular Allergy ... Additionally, spirometry was not routinely performed during ED and hospital admissions Although other EDs and hospitals in the metropolitan area evaluate, treat, and admit pediatric patients with asthma ... http://www.clinicalmolecularallergy.com/content/3/1/2 in data collection MCZ participated in coordination and manuscript preparation JPS participated in design, coordination and manuscript preparation KJK participated in design and coordination...

Ngày tải lên: 13/08/2014, 13:22