a comparative study of greek prefecture websites

Ngày tải lên: 07/11/2012, 14:17

... 14 a, Use of Grammar 14 a1 Modality 14 a2 Use of Active / Passive voices 14 a3 Sentence order 15 a4 Length of sentences 15 a5 Kinds of sentences 16 b Use of vocabulary 17 b1 Archaic words and ... Purposes and typical legal characteristics of the International 10 Declaration on Human Rights 3.2.1 Purposes 10 3.2.2 Typical legal characteristics 10 3.3 A study of the discourse structure and some ... Convention and its realization 23 4.3.2.2 Remarks 26 a, Use of Grammar 26 a1 Modality 26 a2 Use of Active/ Passive voices 27 a3 Sentence order 27 a4 Length of sentences 27 a5 Kinds of sentences...

Ngày tải lên: 07/11/2012, 14:17

... Modality A modal form is a provision of syntax that indicates the predication of an action, attitude, condition, or state other than that of a simple declaration of fact The modality of a grammatical ... language learning, and is therefore of great importance to language teachers Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while these remain ... INTERNATIONAL DECLARATION ON HUMAN RIGHTS 10 3.1 DEFINITION OF AN INTERNATIONAL DECLARATION 'International Declaration' generally is defined as "a formal statement agreed on or used by all or many...

Ngày tải lên: 07/11/2012, 14:17

... financial assistance in case of need; (c) Make higher education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance ... performances and materials Article 35 States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic in children for any ... from all forms of sexual exploitation and sexual abuse For these purposes, States Parties shall in particular take all appropriate national, bilateral and multilateral measures to prevent: (a) ...

Ngày tải lên: 07/11/2012, 14:17

... display their emotions more openly than Americans and to view Americans as unemotional and cold Meanwhile, it is believed that Americans are much more direct than Asians, particularly Vietnamese As ... developed around very narrow topic areas, such as news for merchants in a specific industry, fans of particular sports, fans of the arts or of specific artists, and participants in the same sorts of activities ... many sources to appear together in the same virtual “space” That means all the journalism and media criticism that print makes possible is now available to anyone who can access a computer, vastly...

Ngày tải lên: 07/11/2012, 14:44

... female 3.3 DATA ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately Second, the trends in each group of data for each social factor of age, as well as ... (the hearer was commented as a chump when was asked to give a talk in the company), clearly it is a case of banter as being commented as a chump may have been perceived as untrue Similarly, the ... 3.1 RESEARCH METHODS This comparative study was mainly a quantitative research based on questionnaires with both Vietnamese and American respondents 3.2 DATA COLLECTION METHODS 3.2.1 Research Instrument...

Ngày tải lên: 26/11/2013, 13:16

... Qaeda network to replace the two men Al-Masri, a native of Egypt, was military leader of al Qaeda in Iraq Al-Baghdadi was leader of the Islamic State of Iraq, an umbrella group that includes al ... Among content words, adjectives and adverbs, particularly the later, are repeated in a very limited rate Almost all of adjectives and adverbs in newspaper articles have neutral nuances of meaning ... topic of the newspaper article Some general statistics of the selected materials are given in the table below: Total number Words Paragraph Average of pieces Total number words Average of per Total...

Ngày tải lên: 14/12/2013, 00:40

... culture and PCR KAVITA MODI – PAREKH ET AL weeks Characterization of Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical Mycobacteria Statistical analysis ... were available 4-8 weeks later As no single gold standard was available for comparison of the performance of the individual tests, an analysis of results was done using a variety of standards ... 877-83 CHANCHAL SINGH MEMORIAL AWARD - 2006 The Tuberculosis Association of India awards every year a cash prize of Rs 1000/- to a medical graduate (non-medical scientists working as bacteriologists,...

Ngày tải lên: 06/03/2014, 04:20

... domain corpus, and MAP (maximum a posteriori) is a traditional model adaptation method, where the parameters of the background model are adjusted so as to maximize the likelihood of the adaptation ... such as number of non-zero features after estimatraining sample has been processed in pass 𝑡 over tion, number of training iterations, and computation the training data The average parameters are ... imposes a kind of implicit regularization, and can closely approximate the effect of L1 regularization in a local sense (Hastie et al 2001) Empirically, smaller values of 𝜖 lead to smaller numbers of...

Ngày tải lên: 08/03/2014, 02:21

... liver of yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexaenoic acid and that several acyltransferase ... was used as an acyl acceptor, the acyltransferase activity of the fish liver microsomes acylated docosahexaenoic acid more effectively than arachidonic acid (Fig 2B) At a fatty acid concentration ... yellowtail Lipids from yellowtail have a preponderance of docosahexaenoic acid over arachidonic acid In fact, docosahexaenoic acid and arachidonic acid made up 28.4% and 3.5%, respectively, of the...

Ngày tải lên: 08/03/2014, 08:20

... (Galicia, Asturias, Cantabria) ES2 Noreste (País Vasco, Navarra, Rioja, Aragón) ES3 Madrid ES4 Centro (Castilla-León, Castilla-La Mancha, Extremadura) ES5 Este (Catalu a, Comunidad Valenciana, ... Baleares) ES6 Sur (Andaluc a, Murcia, Ceuta y Melilla) ES7 Canarias Greece GR Voreia Ellada (Anatoliki Makedonia, Thraki, Kentriki Makedonia, Dyttiki Macedonia, Thessalia) GR2 Kentriki Ellada ... suggests that especially in the Eastern European countries material deprivation and a lack of social rights are partly determined by traditional traits of social class, such as education and income...

Ngày tải lên: 14/03/2014, 17:20

Ngày tải lên: 16/03/2014, 03:20

... human annotation In Proceeding of AMTA T Takezawa, E Sumita, F Sugaya, H Yamamoto, and S Yamamoto 2002 Toward a broad-coverage bilingual corpus for speech translation of travel conversations ... on Empirical Methods in Natural Language Processing and 947 Computational Natural Language Learning (EMNLP-CoNLL’2007), pp 277 – 286, Prague, Czech Republic, June S Jayaraman and A Lavie 2005 ... Zhu 2002 BLEU: a method for automatic evaluation of machine translation In Proceeding of ACL-2002, pp 311-318 A I Rosti, N F Ayan, B Xiang, S Matsoukas, R Schwartz and B Dorr 200 7a Combining Outputs...

Ngày tải lên: 17/03/2014, 01:20

... (Chen and Wei, 2008) is a variation of SARSA(λ) that uses the least squares method to find the optimal policy Incremental Actor Critic (IAC) (Bhatnagar et al., 2007) and Natural Actor Critic (NAC) ... empty set of states, A is a non empty set of actions and P is a transition probability kernel that assigns probability measures over X × R for each state-action pair (x, a) ∈ X × A We can also define ... Q-Learning, Q(λ) and AC-QV are significantly faster than the rest algorithms On the other hand, all algorithms except for NAC, IAC and LS-SARSA have the major drawback of the size of the table representing...

Ngày tải lên: 17/03/2014, 22:20

... was amplied by PCR from genomic DNA using the sense primer 5Â-AAGCTTATGTCAACACGACGACTTATGCAC A- 3Â and the antisense primer 5Â-GGATCCGGATCCTT AAGCCGTTCCCTGTTC-3Â with additional HindIII and BamHI ... NADH Western blot analyses of trypanosomatid cell extracts Polyclonal antisera against L major GLO1 were raised in adult male Wistar rats An initial injection of 100 lg of puried antigen, emulsied ... the amount of l-lactate detected in the supernatants of both L major and T cruzi cultures These data suggest that T brucei may metabolize methylglyoxal by an alternative pathway In a previous study...

Ngày tải lên: 23/03/2014, 06:20

... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTG GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTC GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACC AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAG CTCAGCCTTGAAACGCGTGGCGGCGAAACTTTTCACCT 5654 FEBS Journal ... mgặL)1 bacterial culture) Peroxidase activity To analyse the peroxidase activity of the putative glutathione peroxidase-like protein an assay was established containing NADPH, glutathione reductase,...

Ngày tải lên: 23/03/2014, 07:20

... evaluation of machine translation In Proceedings of ACL, pages 311–318 Adam Pauls and Dan Klein 2011 Faster and smaller n-gram language models In Proceedings of the 49th Annual Meeting of the Association ... New York, April Association for Computational Linguistics Carl Pollard and Ivan A Sag 1994 Head-Driven Phrase Structure Grammar University of Chicago Press Ivan A Sag, Thomas Wasow, and Emily ... pred → arg1 arg2[/arg3] → pred → arg1 → mod [arg1 →] pred → arg2 [arg1/]arg3 → pred → arg2 pred/arg2 → arg3 → arg1 [arg2 →] pred → arg1 arg1[/arg2[/arg3[/arg4]]] → pred arg1[/arg2[/arg3[/arg4]]]→pred→mod...

Ngày tải lên: 30/03/2014, 17:20

... Partiya Ukrainy (Ob”ednana) (Social Democratic Party of Ukraine - United) Ukrains’ka Natsional’na Asambleya (Ukrainian National Assembly) Ukrains’ka Natsional’na Samooborona (Ukrainian SelfDefense Force) ... Latvijas Nacionglg Neatkarrbas Kustrba (Latvian National Independence Movement) Latvijas Sociglistiskg Partija (Latvian Socialist Party) Latvijas Tautas Fronte (Latvian Popular Front) Latvijas ... (U) UNA UNSO Communist Party of Ukraine Narodno-Demokratychna Partiya (Popular Democratic Party) Sotsialistychna Partiya Ukrainy (Socialist Party of Ukraine) Sotsial-Demokratychna Partiya Ukrainy...

Ngày tải lên: 04/06/2014, 00:49