... way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the access ... introduction of error and loss of time efficiency Nowadays, the use of computers and statistical programmes is fairly standard for the analysis of quantitative data Aside from common database and statistical ... appraisal The origins of rapid market appraisal (RMA) are similar to those of rapid rural appraisal (RRA), in that formal surveys were often seen as lengthy, costly and management intensive As a...
Ngày tải lên: 07/03/2014, 00:20
... Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi ... locations of the sensors The time delay is taken with 1/500 and 1/800 of total duration time T Some of the controlled results are shown in table and Fig and In Fig and 7, thin and dotted lines are ... as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration The characteristics of the beam are taken from [12] The beam has a square cross-section...
Ngày tải lên: 28/03/2014, 13:20
Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems" doc
... Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi ... locations of the sensors The time delay is taken with 1/500 and 1/800 of total duration time T Some of the controlled results are shown in table and Fig and In Fig and 7, thin and dotted lines are ... as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration The characteristics of the beam are taken from [12] The beam has a square cross-section...
Ngày tải lên: 28/03/2014, 13:20
Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt
... is also apparent and the data were log-transformed, resulting in more homogeneous variances A balanced, nested analysis of variance was used to compare the variation between and within trees and ... importance of variation between and within mature trees, additional samples were used to confirm the variation of soluble ellagitannins with heartwood age MATERIALS AND METHODS Materials Variation ... estimate of mean heartwood age as a and the mean total ellagitannins found in samples from each forest (table II) as T the concentrations of tannins in the , a oh new, outermost heartwood T can...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo y học: "Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis" pot
... 5'-GATCCCCCTGGTTAGCAGAAACGTGCTTCAAGAGAGCA CGTTTCTGCTAACCAGTTTTTGGAAA-'3 ATM_II (p480): 5'-GATCCCCGATACCAGATCCTTGGAGATTCAAGAG ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', a generous gift from R Agami (ATM ... was knocked-down using a combination of two different siRNAs.) Rel _A: 5'-GATCCCCGAAGAGTCCTTTCAGCGGATTCAAGAGATCCGCTGAAAG GACTCTTCTTTTTGGAAA -3' p53: 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG ... 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG GAGTCTTTTTGGAAA-'3 (previously described in Brummelkamp et al [24]) LacZ: 5'-GATCCCCAAGGCCAGACGCGAATTATTTCAAGAGAATAATTCGCGTCT GGCCTTTTTTTGGAAA-3' http://genomebiology.com/2005/6/5/R43...
Ngày tải lên: 14/08/2014, 14:21
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf
... method Sadao Kurohashi and Makoto Nagao 1994 Kn parser: Japanese dependency/case structure analyzer In Proceedings of the Workshop on Sharable Natural Language Resources, pages 48–55 Sadao Kurohashi ... models Transactions of Information Processing Society of Japan, 40(9):3397–3407 (in Japanese) Andrew Kehler, Douglas Appelt, Lara Taylor, and Aleksandr Simma 2004 The (non)utility of predicate-argument ... 719–724 Sadao Kurohashi and Makoto Nagao 1998b Japanese Morphological Analysis System JUMAN version 3.5 Department of Informatics, Kyoto University (in Japanese) References Eugene Charniak and Mark...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot
... the amide nitrogen atoms of the drug and the N3 and O2 atoms of A and T base pairs, respectively, clearly cataloging the structure to class I As the additional bulky NH2 group of GC base pairs at ... was investigated by evaluating the interaction energies and hydrogen positions of the end fragment and the bases of base pair T8 -A2 5 and base G9 (Table 2, Fig 4) For the bases of the A2 5-T8 base ... geometry based on HF ⁄ 6–31G* calculations of the interaction between (A) the amidinium end and bases A2 5, T8 and G9; and (B) the guanidinium end and bases A5 , T28 and A6 Intermolecular geometry...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: "A Combination of Active Learning and Semi-supervised Learning Starting with Positive and Unlabeled Examples for Word Sense Disambiguation: An Empirical Study on Japanese Web Search Query" pdf
... unlabeled examples is effective The accuracies of with-EM, random and without-EM are gradually increasing according to the percentage of added hand labeled examples and catch up that of human and ... in table Human labeling, abbreviated as human, is an active learning approach starting with human labeled negative examples The number of hu- 63 man labeled negative examples in initial training ... negative dataset ) 13 end Full text query for initial positive examples Wega Loft Wega AND TV Loft AND (Grocery ORStationery) Honda AND Keisuke Tsubaki AND Shiseido Honda Tsubaki Loft store name...
Ngày tải lên: 23/03/2014, 17:20
A Game of Two Halves Football, television and globalization docx
... Football audiences read and appropriate hybrid semiotic structures composed of players and managers, tradition and history, board members and fans, stadia and landscapes and their diverse representation ... of football: fandom and the public sphere 49 Football and cultural globalization 67 Summary to Part II 101 PART III Football and postmodernity 103 Football, formal rationality and standardization ... part of my argument is dedicated to the cultural, social and economic conditions of football and fandom Chapter analyses the impact of cultural universalization on football fandom, arguing that...
Ngày tải lên: 31/03/2014, 19:20
Báo cáo hóa học: " A combination of hard and soft templating for the fabrication of silica hollow microcoils with nanostructured walls" pptx
... of PDI dye, and Prof Po-Da Hong and Prof Shawn D Lin (National Taiwan University of Science and Technology) for experimental support Author details International Iberian Nanotechnology Laboratory ... study and participated in its design and coordination, as well as in sample preparation and characterization by TEM, SEM and SAXS NV participated in TEM observations and in spectroscopic measurements ... Universidad de Santiago de Compostela, Santiago de Compostela, 15782, Spain 5Toyota Physical & Chemical Research Institute, Nagakute, Aichi, 4801192, Japan Additional material Additional file...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo hóa học: " A Novel Method to Fabricate Silicon Nanowire p–n Junctions by a Combination of Ion Implantation and in-situ Doping" docx
... calculated the depletion width [20] as 40 nm This value is significantly smaller than the average Fig An illustration of how the p–n junction is formed in a Si NW a An SEM image of a NW indicating ... heavy mass compared to phosphorus, the Au caps on top of the NWs were removed (Fig 1c) by an aqueous solution of KI and I2, a standard Au etchant This resulted in the reduction in the average length ... in-situ doping of NWs successively by two different dopants [6] A two- step implantation of phosphorus ions at room temperature was used to obtain a rectangular dopant profile The implantation energies...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo y học: "A combination of autoantibodies to cyclic citrullinated peptide (CCP) and HLA-DRB1 locus antigens is strongly associated with future onset of rheumatoid arthritis" potx
... Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, ... study, calculations are based on the combination of SE and the analysed autoantibodies This is because anti-CCP antibodies and RFs are significantly associated, and consequently prediction of RA is ... or an RF of any isotype, in comparison with individuals not having any of the factors or having any one of them separately In particular, the combination of SE gene carriage and the presence of...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking" pdf
... fractured surface of articular cartilage after trauma or transplantation The objective of this study was to investigate the initiation of immediate bonding of articular cartilage blocks by means of combining ... incorporated into the cartilage and can be easily removed and the scar tissue can be remodelled by cell and extracellular matrix turnover Degradation Degradation or swelling of articular cartilage ... Breevaart BJ, In der Maur CD, Bos PK, Feenstra L, Verhaar JA, Weinans H, van Osch GJ: Improved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx
... model used as the 3D query in database searching was retained as a hit Two database searching options such as Fast/Flexible and Best/Flexible search are available in DS V2.5.5 Of these two, the ... Department of Medical Research of Mackay Memorial Hospital HYL, WT, and YH are professors from National Taiwan University, National Taipei University of Technology, and Taipei Medical University, ... Bartolini M, Cavalli A, Tarozzi A, Andrisano V, Minarini A, Rosini M, Tumiatti V, Bergamini C: Novel class of quinonebearing polyamines as multi-target-directed ligands to combat Alzheimer’s disease J...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "''''Foot'''' and ''''surgeon'''': a tale of two definitions" doc
... might be made as to whether - from a medical standpoint - it is reasonable to allow a practitioner treating the foot to consider and treat other anatomical systems that interact with and affect ... management of foot and ankle disorders Possibly, some of our orthopaedic readers will disagree, and perhaps some of our podiatric colleagues may be dismayed that we have not more emphatically advocated ... of all soft tissues (muscles, nerves, vascular structures, tendons, ligaments and any other anatomical structures) that insert into the tibia and fibula in their articulation with the talus and...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc
... the combination of amantadine and IFN-alpha against HAV replication were stronger than those by amantadine or IFN-alpha monotreatment IFN-alpha was more effective than amantadine against the HAV ... were evaluated with ELISA Suppression of HAV replication by the combination of amantadine and IFN-alpha was stronger than those of Page of amantadine alone, IFN-alpha alone, and untreated control ... Kiyohara and Tatsuo Kanda performed the experiments LY, Tomoko Kiyohara, Tatsuo Kanda and FI analyzed data and wrote the manuscript Tomoko Kiyohara, KI and TW contributed to experiments using a...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo khoa học: "A Combination of Atrioventricular Block and Sinoatrial Block in a Horse" ppt
... T, Hasegawa M, Tomioka Y: Cardiopathology of sinoatrial block in horses Jap J Vet Sci., 1985, 47, 45-54 Matsui K, Amada A, Sawazaki H: Second -degree 175 atrioventricular block observed in a Thoroughbred ... (Smetzer 1967) Although AVB and SAB may occur simultaneously on the ECG of a horse their association is very rare A review of literature showed that only one case has been reported in a doctral thesis ... and vagally mediated cardiac dysrythmias are more comActa vet scand vol 46 no 3, 2005 mon in trained horses although AVB has also been reported in a 2.5 months thoroughbred foal (Matsui et al 1988).There...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: "Changes in 10-12 year old’s fruit and vegetable intake in Norway from 2001 to 2008 in relation to gender and socioeconomic status - a comparison of two cross-sectional groups" pptx
... correlation of this scale was 0.75 [20] The correlation between the scale and a validation method (7 day food diary) was 0.32 in a separate validation study of 85 6th grade pupils, a correlation ... interval FV intake, fruit and vegetable intake EDU high, higher parental education EDU low, lower parental education Hilsen et al International Journal of Behavioral Nutrition and Physical Activity ... the Marks; ANOVA: Analysis of variance between groups; SPSS: Statistical Package for the Social Sciences; SE: standard error; CI: confidence interval Author details Faculty of Health and Sport,...
Ngày tải lên: 14/08/2014, 08:21
A study of welded built up beams made from titanium and a titanium alloy
... experimentally and theoretically evaluate Ti alloy beams fabricated and tested under both static and fatigue loading To develop analysis and design approaches for static and fatigue performance of ... where balls have to be hit fast and far, weight savings is of advantage Frames of tennis racquets and baseball bats are also made from titanium Titanium golf club shafts, tennis racquet frames, ... sheets and plates of titanium to make large structural components that satisfy the structural performance standards that are comparable with the performance standards of those structural parts that...
Ngày tải lên: 04/07/2016, 17:26
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"
... expressed as mean ± standard deviation after ascertaining a normal distribution We performed the unpaired or paired t-tests and one-way repeated measures analysis of variance (ANOVA) If the ANOVA test ... imaging (VVI) is a clinically feasible approach for strain measurements in infarcted myocardium allowing an accurate assessment of global and regional myocardial function, and a differentiation ... there are no normal values of a large cohort of healthy controls and validated recommendations for the PFR in VVI analysis are still not available The data of former studies showed that a mean PFR...
Ngày tải lên: 25/10/2012, 11:15