... agacccccacagtttacgagggctcagtggtttgccatccagcacatcagt R P P Q F T R A Q W F A I Q H I S 18 ctgaacccccctcgatgcaccattgcaatgcgggcaattaacaattatcga L N P P R C T I A M R A I N N Y R 35 tggcgttgcaaaaaccaaaatacttttcttcgtacaacttttgctaatgta ... aacaattgtcatcggagtagattccgggtgcctttactccactgtgacctc N N C H R S R F R V P L L H C D L c ataaatccaggtgcacagaatatttcaaactgcaggtatgcagacagacca 86 I N P G A Q N I S N C R Y A D R P T ggaaggaggttctatgtagttgcatgtgacaacagagatccacgggattct ... tggcgttgcaaaaaccaaaatacttttcttcgtacaacttttgctaatgta W R C K N Q N T F L R T T F A N V 52 gttaatgtttgtggtaaccaaagtatacgctgccctcataacagaactctc V N V C G N Q S I R C P H N R T L 69 aacaattgtcatcggagtagattccgggtgcctttactccactgtgacctc...
Ngày tải lên: 12/08/2014, 13:22
... cloned the cDNA of each A single amino acid (aa) substitution was confirmed to affect the thermal stabilities of vertebrate DNases I and, furthermore, one of the postulated mechanisms whereby thermal ... be evaluated as one of the factors that reflect the DNase I activity levels in vivo [13] As a lack of, or decrease in, DNase I activity has been suggested to be a critical factor in the initiation ... found to be more adequate for molecular evolutionary analysis of the DNase I family The mammalian group formed a relatively tight cluster, while the snake (E quadrivirgata, E climacophora and A blomhoffii),...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Water Pollution Control - A Guide to the Use of Water Quality Management Principles ppt
... resorts as Guanabara Bay in Brazil, Vina del Mar in Chile and Cartagena in Colombia Offensive smells, floating materials (particularly sewage solids) and certain other pollutants can create aesthetically ... than, or equal to, half the concentration value of the water quality objective Another approach requires the use of the mean concentration of a substance as an evaluation criterion This approach ... of water and/or the quality of the suspended particulate matter, the bottom sediment and the biota Many water quality criteria set a maximum level for the concentration of a substance in a particular...
Ngày tải lên: 26/02/2014, 20:20
Water Pollution Control - A Guide to the Use of Water Quality Management Principles ppt
... of the Water and Sanitation Division of the World Bank, and of the environment team of the Urban Development Division and the UNDP/UNCHS/World Bank Urban Management Programme The author is particularly ... last three and a half years The Council is grateful to them, and I want to express my own personal appreciation for the voluntary time and effort they have devoted to the task The result is a ... members The basic information and data for Case Study XII were gathered for the development of a Water Management and Conservation Plan for the country of Jordan by the author, in the year 1992,...
Ngày tải lên: 06/03/2014, 23:20
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... (RRA) approach to initial project preparation was developed By the end of the decade, there was a range of RRA methods and approaches available which then gave rise to participatory rural appraisal ... from a different area or family are disadvantaged, as they have to work their way in and probably have to learn the hard way, by learning from their mistakes The SLA embraces a wider approach to ... interchangeable For example, natural capital may be the basis for financial capital (land as collateral that can be used to obtain a loan) Or natural capital might be linked to social capital In many societies,...
Ngày tải lên: 07/03/2014, 00:20
The Lady and Sada San A Sequel to The Lady of the Decoration potx
... entire families and villages It has simply ravaged northern Manchuria and the country 30 The Lady and Sada San about Jack says so deadly are the effects of these germs in the air that if a man walking ... interest as that of Sada San as she told it to me, one long, lazy afternoon as I lay on the couch in my cabin, The Lady and Sada San thanking my stars I was getting the best of the bare tablecloth and ... faculties and a few emotions, try chaperoning a young room-mate answering to the name of Sada San, who is one-half American dash, and the other half the unnamable witchery of a Japanese woman;...
Ngày tải lên: 15/03/2014, 06:20
T-Shirts and Suits A Guide to the Business of Creativity pptx
... Chan, Chairman of Shanghaibased computer games manufacturer Shanda Entertainment, operates in a culture where pirating software is rife Software pirating was a threat but he turned it into an ... change and ready for change? Are there barriers to change? Collaborators (Alliances, Partnerships and Networks) What are the strengths and weaknesses of our associations with other businesses and ... Ideas in Action — see page 102 To stay ahead of the game we need to anticipate changes, not just react to them This requires constant ‘scanning’ of the external environment and I liken this to a...
Ngày tải lên: 15/03/2014, 21:20
Water Pollution Control: A guide to the use of water quality management principles docx
... resorts as Guanabara Bay in Brazil, Vina del Mar in Chile and Cartagena in Colombia Offensive smells, floating materials (particularly sewage solids) and certain other pollutants can create aesthetically ... national criteria On many occasions, the application of water quality criteria from other countries requires additional ecotoxicological testing An example of the adaptation of a traditional water ... of water and/or the quality of the suspended particulate matter, the bottom sediment and the biota Many water quality criteria set a maximum level for the concentration of a substance in a particular...
Ngày tải lên: 23/03/2014, 00:20
Water Pollution Control - A Guide to the Use of Water Quality Management Principles doc
... account the technical and financial feasibility of wastewater treatment In this way a treatment technology, or any other action, can be taken to remove or prevent the discharge of the contaminants of ... treatment and disposal of wastewater flows are essential to control the transmission of waterborne diseases They are also essential for the prevention of non-reversible degradation of the urban ... minimisation covers an array of technical and nontechnical measures aiming at the prevention of the generation of waste and pollutants It is the conceptual approach to industrial production that...
Ngày tải lên: 23/03/2014, 00:20
Receiving and Shipping Dangerous Goods - A Guide to the Transportation of Dangerous Goods Regulations for Photo Processors and Digital Imagers pptx
... Placards Placards are a larger version of the labels and must be applied on each side and each end of the transport vehicle, so that the placards are visible from any direction Labels and placards ... no mass explosion hazard Class - Gases Class Gases are substances that are gaseous, a mixture of gases, an article charged with a gas, or an aerosol Some large photo processing and digital imaging ... Glacial acetic acid Acetic acid solution, class (3), UN2789, PGII The two parts of a hazard class are: Primary hazard class Subsidiary hazard class (in parenthesis) UN Number The UN (United Nations)...
Ngày tải lên: 23/03/2014, 08:21
A Forgotten Empire: Vijayanagar; A Contribution to the History of India doc
... Muhammadan aggression Reign of Bukka I Kampa and Sangama? The Bahmani kingdom established, 1347 Death of Nagadeva of Warangal -Vijayanagar's first great war Massacres by Muhammad Bahmani ... is the portico of the palace of the RAI Above each bazaar is a lofty arcade with a magnificent gallery, but the audience-hall of the king's palace is elevated above all the rest The bazaars are ... have most to do; the Barid Shahs of Bidr or Ahmadabad; the Imad Shahs of Birar; the Nizam Shahs of Ahmadnagar; and the Qutb Shahs of Golkonda Adil Shah was the first of his line at Bijapur, and...
Ngày tải lên: 23/03/2014, 23:21
cruising alaska [electronic resource] a guide to the ports of call.
... portion of the state, including the area around the Alaska Peninsula and the Gulf of Alaska as well as the Aleutians and the panhandle, this is the region of most interest to visitors All cruise ... of Alaska lies along the long strip of coast from just beyond the Canadian border at Ketchikan north to Yakutat Bay and then west along the south coast bordering the Gulf of Alaska Roads on the ... Alaska and the most beautiful It has an abundance of magnificent snow- and ice-covered mountains, glaciers and fjords The Boundary Range separates Alaska from Canada On the water side is the famous...
Ngày tải lên: 29/05/2014, 15:16
blackwell - a companion to the philosophy of science (2001)
Ngày tải lên: 05/06/2014, 11:03
the particle odyssey a journey to the heart of matter nov 2004
... hydrogen to uranium – that occurs naturally on Earth; and we have created and characterized in the laboratory atoms of at least 15 other elements heavier than uranium We know that the atoms of all these ... Voyage into the Atom X-Rays and Radioactivity The First Particle Rutherford and the Atom Inside the Nucleus Splitting the Atom The Structure of the Atom The Electron The Nucleus The Proton and the ... contains almost all the atom’s mass If an atom were the size of the Earth, then the nucleus would be the size of a football stadium The atom’s volume is mostly empty space Rutherford and the Atom...
Ngày tải lên: 11/06/2014, 10:02
a guide to the end of the world everything you never wanted to know sep 2004
... well after the bell has rung and the athletes are hurtling down the final straight of the last lap As they battle for the tape, dinosaurs appear and then disappear while the leaders Page A VERY ... disconcerting to say the least and begged the question in many quarters what if that were the Earth? Natural hazards and us If you were not already aware of the scale of the everyday threat from nature then ... that are also susceptible to volcanic eruptions and earthquakes Talk to the citizens of Mammoth in California about the threat of their local volcano exploding into life, or to the inhabitants...
Ngày tải lên: 11/06/2014, 10:21
Water Pollution Control - A Guide to the Use of Water Quality Management Principles 6 pot
... as water quality data • A data storage and retrieval system • A data manipulation and analysis system which transforms the data into a common form allowing for spatial analysis • A data reporting ... stored to ensure that they maintain accuracy and to allow easy access, retrieval and manipulation The volume of data to be acquired and stored is dictated by the size and level of ambition of ... graphical analyses that are straightforward and easy to perform For larger volumes of data, a generalised data storage system, based on a relational database, will provide more powerful data management...
Ngày tải lên: 21/06/2014, 09:20
Water Pollution Control - A Guide to the Use of Water Quality Management Principles 7 ppt
... Protect Class II standard Attain Class II standard Attain Class III standard Attain Class III Attain Class II standard standard Despite the successes mentioned, the water quality of the Huangpu River ... I.1 Location map of India showing the Ganga river The purity of the water depends on the velocity and the dilution capacity of the river A large part of the flow of the Ganga is abstracted for ... the wastewater quantity and the water quality at the mixing zone can still achieve Class III water quality standard for most variables According to physical and mathematical modelling of the wastewater...
Ngày tải lên: 21/06/2014, 09:20
Water Pollution Control - A Guide to the Use of Water Quality Management Principles 9 docx
... of Applied Systems Analysis (IIASA) at Laxenburg, Austria, Thames Water International in Reading, England, and Canada's Centre for Inland Waters near Toronto, Canada By means of such models, a ... and the performance of specific facilities The preparation of the action plan has been notably weakened in key areas because of the lack of appropriate, consistent and reliable data No adequate ... communities These plants will boast a total treatment capacity of 1,833 s-1 In order to control and monitor water quality in the basin, CNA keeps a regional water agency with headquarters in Guadalajara...
Ngày tải lên: 21/06/2014, 09:20