... ((AUC ) × Dose ) A BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis ... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug Methods Materials Pullulan...
Ngày tải lên: 23/04/2013, 21:38
... C5e and C6 Dynamic left/right angle patch panels Each label sheet contains 42 individual labels SH PP24AC6T PP48C6T PP24AC5ET PP48C5ET ADCLS-DAA Paper label sheet for ADC faceplate and surface ... Each label sheet contains 35 individual labels SH ADCLS-CL1 2A Adhesive label for ADC’s patch cords or horizontal cable 1" x 1/2" Each label sheet contains 14 individual labels SH ADCLS-CL2 4A Adhesive ... TPNP-24NC10-BK ADCLS-CTAPC Adhesive label for ADC’s CopperTen Angled patch panel center label strip Each label sheet contains 12 individual labels SH TPNP-24APC10-BK TPNP-24APC10-UN ADCLS-CTAPA 3/08...
Ngày tải lên: 10/12/2013, 19:15
Tài liệu Stability and Control of Large-Scale Dynamical Systems pptx
... dealing with the mathematics of specic applications areas and real-world situations Stability and Control of Large-Scale Dynamical Systems A Vector Dissipative Systems Approach Wassim M Haddad ... Princeton Series in Applied Mathematics publishes high quality advanced texts and monographs in all areas of applied mathematics Books include those of a theoretical and general nature as well as ... in large-scale systems several Lyapunov functions arise naturally from the stability properties of each subsystem An alternative approach to vector Lyapunov functions for analyzing large-scale...
Ngày tải lên: 12/02/2014, 16:20
Tài liệu The Decline of Traditional Banking: Implications for Financial Stability and Regulatory Policy doc
... European banks The success of the Japanese economy and Japan’s high savings rate gave Japanese banks access to cheaper funds than were available to American banks This cost advantage permitted Japanese ... of making accurate marketvalue estimates of assets and liabilities Historical-cost accounting has an important advantage in that it is easier to value assets and liabilities Market-value accounting, ... that there is some reason to believe that derivatives pose a threat to financial stability It raises the prospect that a default by a major OTC derivatives dealer—and in particular by a major bank—...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Báo cáo khoa học: Combinatorial approaches to protein stability and structure pdf
... mutase is thought to catalyze a Claisen condensation principally by binding chorismate in a conformation that favors the pericyclic reaction and allows transition-state stabilization by a cationic ... surface of phage, typically between a coat protein and a binding domain, such as a hexahistidine tag The phage are then immobilized (for example, on Ni-nitriloacetic acid agarose) and treated ... lytic phage; and lac repressor prevents transcription of b-galactosidase, which can be assayed by survival on lactose minimal medium or hydrolysis of a chromogenic galactoside The latter case illustrates...
Ngày tải lên: 19/02/2014, 12:20
Đề tài " Stability and instability of the Cauchy horizon for the spherically symmetric Einstein-Maxwell-scalar field equations " doc
... The analytical content of this paper is thus a combination of a stability theorem and a blow-up result for a system of quasilinear partial differential equations in one spatial and one temporal ... differential equations to say something significant about fundamental physics Unfortunately, all the difficulties of quasilinear hyperbolic equations with large data are present in this problem and make a ... Einstein-Maxwell equations is similar to o the Kerr solution’s black hole, and in particular, also has as future boundary a Cauchy horizon leading to unpredictability for every small nonzero value...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot
... was analyzed by catalytic activity measurements performed under standard conditions Reactivation assay of SsMTAPII, PfPNP and their CXC-lacking mutants The activity of SsCSC and PfCGC as catalysts ... concentration of mm was then added and A2 96, as a result of RNase-catalyzed cCMP hydrolysis, was monitored continuously for 210 at 30 °C The positive control was the reactivation of sRNaseA catalyzed ... the reactivation of sRNaseA by various oxidative folding catalysts - - -, None; , PDI; d, SsCSC; , PfCGC Each value is the average of three separate experiments as PDI, catalyzing the rearrangement...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition pptx
... CCCTCCTCCCAGCGCCCTCCC CAGAGGGAGGGCGCTGGGAGGAGGGGCTG CAGCCCCTCCTCCCAGCGCCCTCCCTCTG CGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCT AGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCG CGCGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCTGC GCAGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCGCG ... would be less stable, at physiological pH as compared to acidic pH, as it has been shown that intercalated hemiprotonated C:C+ base pairs are stable at acidic pH [60,61,62] To understand the structure ... USA) and origin 7.0 (Microcal Inc., Northampton, MA, USA) The following equations were used to calculate the thermodynamic data: Au ẳ bu ỵ mu T ị 1ị Al ẳ bl ỵ ml T ị 2ị Keq ẳ a a 3ị ATị ẳ a...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Thermodynamic stability and folding of proteins from hyperthermophilic organisms doc
... Thermotoga maritimaa Thermococcus kodakaraensisb Thermotoga maritimaa Pyrococcus furiosusb Thermococcus kodakaraensisb Thermotoga maritimaa 93 93 95 90 103 85 85 90 97 95 90 95 90 103 95 90 b a b a b ... concentrations, AaFd1 and AaFd5 were found to exhibit midpoints well above 100 °C at pH in buffer (Table 2) At pH 2.5, both AaFd5 and AaFd1 are less stable than at neutral pH, indicating that electrostatic ... 53 Ogasahara K, Nakamura M, Nakura S, Tsunasawa S, Kato I, Yoshimoto T & Yutani K (1998) The unusually slow unfolding rate causes the high stability of pyrrolidone carboxyl peptidase from a hyperthermophile,...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
... the sample to high intensity light beam, was restricted to < 3% of the initial intensity and was always taken into consideration in the analysis of the titration data Akhavan S, Mannucci PM, Lak ... Haemost 84, 989–997 De Cristofaro R, Akhavan S, Altomare C, Carotti A, Peyvandi F & Mannucci PM (2004) A natural prothrombin mutant reveals an unexpected influence of A- chain structure on the activity ... k1), as seen experimentally In analogy with the values calculated in enzymatic experiments, an increase of % 0.5 pK units of the His57 in DK9 mutant was also calculated analyzing the NAPAP data...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Context-dependent effects of proline residues on the stability and folding pathway of ubiquitin docx
... 276–288 Gunasekaran, K., Nagarajaram, H .A. , Ramakrishnan, C & Balaram, P (1998) Stereochemical punctuation marks in protein structures: glycine and proline containing helix stop signals J Mol ... contribute a small destabilizing effect The contrasting effects of the S19P, P3 7A and P3 8A mutations on stability appear to reflect a complex balance between entropic factors relating to changes in backbone ... M (1997) Transient aggregates in protein folding are easily mistaken for folding intermediates Proc Natl Acad Sci USA 94, 6084–6086 16 Kamagata, K., Sawano, Y., Tanokura, M & Kuwajima, K (2003)...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: Processing, stability, and kinetic parameters of C5a peptidase from Streptococcus pyogenes pptx
... strain 90–226 as a template To clone the scpA gene, we designed the following forward 5¢-CCC GAA TTC AAT ACT GTG ACA GAA GAC ACT CCT GC-3¢ and reverse 5¢-CCC GGA TCC TTA TTG TTC TGG TTT ATT AGA ... higher than that observed at pH 7.4 Analysis of Ac-SQLRANISH-pNA cleavage by C 5a peptidase revealed that estimated Michaelis constant value is too high and exceeds maximum substrate concentration ... sites are indicated as (+) The late intermediate of autocatalytic processing starts at Ala72, while the terminal product of maturation starts at Asp79 The position of identified cleavage site catalyzed...
Ngày tải lên: 08/03/2014, 16:20
FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION pptx
... ascendancy of finance over industry, the international finance capital was able to assume a dominant role so as to act as the sole arbiter aiming at immediate financial gain, rather than long term ... Institute of Statistics (SIS) Manufacturing Industry Annual Surveys To arrive at “wage rates” and the “average labor product”, we have used data on “total wages paid” and “value added” divided, ... the sector has been characterized by Sraffian dynamics in the aggregate, with persistence of mark-ups against wage increases (See also Boratav, Yeldan and Köse, 2000, and Yentürk and Onaran, 1999...
Ngày tải lên: 15/03/2014, 19:20
Báo cáo khoa học: Stability and fibril formation properties of human and fish transthyretin, and of the Escherichia coli transthyretin-related protein potx
... determinant in amyloid disease diversity Proc Natl Acad Sci USA 99(Suppl 4), 16427– 16432 32 Tajiri T, Ando Y, Hata K, Kamide K, Hashimoto M, Nakamura M, Terazaki H, Yamashita T, Kai H, Haraoka K ... surface was analyzed with a Nanoscope IIIa multimode atomic force microscope (Digital Instruments, Santa Barbara, CA, USA), using Tapping Mode in air A silicone probe was oscillated at around 270 ... removed and 200 lL of distilled water was added The material was vortexed, and aliquots of 3–5 lL were applied to Formvar-coated copper grids Contrast was achieved with 2% uranyl acetate in 50% ethanol,...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Crystal and solution structure, stability and post-translational modifications of collapsin response mediator protein 2 pdf
... Ohshima T, Sasaki Y, Suzuki H, Yanai S, Yamashita N, Nakamura F, Takei K, Ihara Y, Mikoshiba K et al (2005) Semaphorin 3A signalling is mediated via sequential Cdk5 and GSK3beta phosphorylation of ... substrates for protein L-isoaspartyl methyltransferase in mouse brain J Biol Chem 281, 33802–33813 24 Arimura N, Inagaki N, Chihara K, Menager C, Nakamura N, Amano M, Iwamatsu A, Goshima Y & Kaibuchi ... 2126–2132 Konarev PV, Petoukhov MV, Volkov VV & Svergun DI (2006) ATSAS 2.1, a program package for smallangle scattering data analysis J Appl Crystallogr 39, 277–286 Majava V, Petoukhov M, Hayashi N,...
Ngày tải lên: 16/03/2014, 06:20
power system stability and control chuong (1)
... of capturing harmonic snapshots Some monitors have the ability to capture harmonic stripchart data In this area, it is critical that the monitor produce accurate data Some commercially available ... nearby large motor start For the distant fault, however, the voltage will sag nearly instantaneously, stay at a fairly constant level for 3–10 cycles, and almost instantly recover to full voltage, ... imbalance may reach a level that causes the drive to trip for input overcurrent Selecting a monitor for variable speed drive tripping can be a challenge Most line disturbance analyzers can easily...
Ngày tải lên: 21/03/2014, 12:11
power system stability and control chuong (2)
... Stillwater, Oklahoma Gary L Johnson Kansas State University Manhattan, Kansas ´ Manuel Reta-Hernandez ´ Universidad Autonoma de Zacatecas Zacatecas, Mexico John G Kappenman Metatech Corporation ... Birmingham, Alabama William A Chisholm Kinectrics=UQAC Toronto, Ontario, Canada James H Gurney BC Transmission Corporation Vancouver, British Columbia, Canada George L Clark Alabama Power Company ... Birmingham, Alabama S.M Halpin Auburn University Auburn, Alabama ß 2006 by Taylor & Francis Group, LLC Andrew Hanson PowerComm Engineering Raleigh, North Carolina Rama Ramakumar Oklahoma State University...
Ngày tải lên: 21/03/2014, 12:11
power system stability and control chuong (3)
... appears that wind speeds have been somewhat lower as temperatures have risen, at least in Kansas It appears that wind speeds can vary significantly over relatively short distances A good data set at ... much Standard heights have been increasing in recent years, from 50 to 65 m or even more A taller tower gets the blades into less turbulent air, a definite advantage The disadvantages are extra cost ... perhaps 10 to 20% A wind power plant developer would like to have as long a data set as possible, with an absolute minimum of one year If the one year of data happens to be for the best year in...
Ngày tải lên: 21/03/2014, 12:11
power system stability and control chuong (4)
... their charge when stored for long periods of time They are already commercially available as ‘‘AA’’ and ‘‘C’’ cell batteries, for small consumer appliances and toys Manufacturing of larger batteries ... commercial application Turnkey 200-kW plants are now available and have been installed at more than 70 sites in the U.S., Japan, and Europe Operating at about 2008C, the PAFC plant also produces heat ... to develop smaller scale SMES plants at a lower price 2.1.4 Battery Storage Even though battery storage is the oldest and most familiar energy storage device, significant advances have been made...
Ngày tải lên: 21/03/2014, 12:11