a challenge for quality assurance in the greek health system

European guidelines for quality assurance in cervical cancer screening pptx

European guidelines for quality assurance in cervical cancer screening pptx

... 4.7.3 Internal quality management Laboratory quality management (preanalytical quality management) Analytical quality management (cytology) Internal continuing education External quality management ... regularly published The information system is an essential tool for managing the screening programme; computing the indicators of attendance, compliance, quality and impact; and providing feedback ... Organisation European guidelines for quality assurance in cervical cancer screening – Second edition Epidemiological guidelines for quality assurance in cervical cancer screening Authors Ahti Anttila...

Ngày tải lên: 15/03/2014, 00:20

324 592 1
European guidelines for quality assurance in breast cancer screening and diagnosis pot

European guidelines for quality assurance in breast cancer screening and diagnosis pot

... rate The historical background incidence rate is usually taken as the rate in the calendar year (or e.g a 3year average of the calendar years) before screening was introduced in the population ... Quality assurance guidelines for surgery 313 7a European guidelines for quality assurance in the surgical management of mammographically detected lesions 7a. 1 Introduction 7a. 2 General performance ... extent arbitrary and cannot in any way be regarded as an alternative to the requirement for reading each chapter as a whole, within the context of the complete guidelines Fundamental points and principles...

Ngày tải lên: 15/03/2014, 00:20

432 460 0
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot

Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot

... guarantees that faults representing errors in the processed data will result in notable non-zero values in syndrome sequence Systematic encoding means that the information bits always appear in ... using the ABFT A systematic form of convolution codes is especially profitable in the ABFT detection plan because no redundant transformations are needed to achieve the processed data after the ... subsystem, the error correction system s inputs may be incorrect Since the data are correct under the single failed subsystem assumption, the data contain no errors and the error Hamidi et al EURASIP...

Ngày tải lên: 20/06/2014, 22:20

12 574 0
Báo cáo hóa học: " Risk factors for low birth weight in Botucatu city, SP state, Brazil: a study conducted in the Public Health System from 2004 to 2008" pptx

Báo cáo hóa học: " Risk factors for low birth weight in Botucatu city, SP state, Brazil: a study conducted in the Public Health System from 2004 to 2008" pptx

... Cátia Regina Branco da Fonseca,Aff1 Corresponding Affiliation: Aff1 Email: catiafonseca@fmb.unesp.br Maria Wany Louzada Strufaldi,Aff2 Email: mwany@uol.com.br Lídia Raquel de Carvalho,Aff3 Email: ... study revealed a reduction in the adequacy indexes for both groups according to the increase in coverage of the indicator used The increase in inadequacy as a result of the modified Kessner Index ... than a risk indicator This sentinel event would have a potentially avoidable occurrence: the infant death A qualitative analysis with individual information examined on a case by case basis could...

Ngày tải lên: 21/06/2014, 19:20

18 422 0
Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx

Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx

... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... injury was decreased, however, and there was also a significant increase in the cardiac index in the NAC-treated group [20] Conclusions This is an exciting time for intensivists involved in the care ... platelet and leukocyte activation In septic pigs, pretreatment with iloprost, an analog of prostacyclin, increased the cardiac output, increased splanchnic blood flow and increased gastric pH In...

Ngày tải lên: 12/08/2014, 20:20

3 469 0
Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx

Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx

... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... that of the Pseudoviridae than to the mean lengths of the Athila and Tat lineages The Pseudoviridae are also more uniformly sized than the Metaviridae A second factor contributing to the abundance...

Ngày tải lên: 14/08/2014, 14:21

16 305 0
báo cáo sinh học:" Human resources for health and decentralization policy in the Brazilian health system" docx

báo cáo sinh học:" Human resources for health and decentralization policy in the Brazilian health system" docx

... system, the municipal administrations started to play a key role in the health arena Noronha et all [6] point out that, as a way to achieve certain goals, decentralization was the only organizational ... 3Collabourating Center of the Pan-American Health Organization/World Health Organization (PAHO/WHO) for Health Workforce Planning and Information, Brazil Authors’ contributions Both authors participated ... municipal health departments outside the capitals; about 20% have a specific career plan for the health division and 29% have a plan for all civil service workers Page of Another strategy analysed in...

Ngày tải lên: 18/06/2014, 17:20

6 323 0
QUALITY AUDIT IN THE NORDIC COUNTRIES: Report prepared for the Nordic Quality Assurance Network in Higher Education (NOQA) doc

QUALITY AUDIT IN THE NORDIC COUNTRIES: Report prepared for the Nordic Quality Assurance Network in Higher Education (NOQA) doc

... stakeholders in quality assurance • Interface between the quality assurance system and management/steering • Relevance of, and access to, quality assurance information • Relevance of, and access to, quality ... presents the Nordic agencies participating in the project and the role played by audit in their quality assurance systems In all the systems quality audit is one of several quality assurance methods ... is available for the task In Finland and Denmark, institutions may choose between a domestic and an international audit group Also, in Denmark and Norway there is a tradition of having at least...

Ngày tải lên: 29/03/2014, 22:20

48 576 0
Báo cáo nghiên cứu nông nghiệp " Biofertiliser inoculant technology for the growth of rice in Vietnam: Developing technical infrastructure for quality assurance and village production for farmers " pot

Báo cáo nghiên cứu nông nghiệp " Biofertiliser inoculant technology for the growth of rice in Vietnam: Developing technical infrastructure for quality assurance and village production for farmers " pot

... Training and Capacity Building Capacity building has involved the generation of quality control methods for application in Vietnam as well as in increased proficiency of participating staff The working ... a complementary opportunity for the Australian team to carry out supporting research relying on facilities and expertise available in Australia but not in Vietnam 3.2 Project Outcomes The main ... magnifying the interface for interaction and allowing independent assessments of progress in the project, while Hien made a single visit to Australia to participate in the th International Symposium...

Ngày tải lên: 22/06/2014, 13:20

12 499 0
Báo cáo y học: "A cluster randomized trial of standard quality improvement versus patient-centered interventions to enhance depression care for African Americans in the primary care setting: study protocol NCT00243425" doc

Báo cáo y học: "A cluster randomized trial of standard quality improvement versus patient-centered interventions to enhance depression care for African Americans in the primary care setting: study protocol NCT00243425" doc

... participating in the study During registration, patients were given a card that informed them their clinician was participating in a study to improve emotional health in African Americans, and ... clinician A report of relevant information was prepared for the patient, primary care clinician, and/or mental health specialist after each contact In contrast to the standard DCM, the patient-centered ... recruitment approach was to have clinical managers at participating primary care sites help identify potential African-American study subjects using administrative and scheduling data Field research staff...

Ngày tải lên: 11/08/2014, 05:21

15 410 0
Báo cáo y học: "Understanding uptake of continuous quality improvement in Indigenous primary health care: lessons from a multi-site case study of the Audit and Best Practice for Chronic Disease project" ppt

Báo cáo y học: "Understanding uptake of continuous quality improvement in Indigenous primary health care: lessons from a multi-site case study of the Audit and Best Practice for Chronic Disease project" ppt

... To the primary health care program managers, for example, ABCD became a method for reorienting service delivery away from an acute care model and toward a population health one Clinic managers ... mitigate against the successful uptake of innovations like ABCD High among these was the turnover and shortage of staff in many Indigenous primary health care services, and in remote areas the additional ... Details 1Australian Primary Health Care Research Institute, Australian National University, Canberra, Australia and 2Menzies School of Health Research, Darwin, Australia Received: 28 July 2009 Accepted:...

Ngày tải lên: 11/08/2014, 05:21

14 441 0
Báo cáo y học: "Critical care in the developing world - a challenge for us all" pptx

Báo cáo y học: "Critical care in the developing world - a challenge for us all" pptx

... as the Global Healthcare Workforce Alliance [5] are currently working to minimize the deficiency of 4.3 million healthcare workers in developing countries With a high proportion of deaths in these ... Gomersall Critical Care 2010, 14:131 http://ccforum.com/content/14/2/131 that we cannot help As acute care specialists we can contribute to education in acute care as well as intensive care Initiatives ... March 2010 Page of References Du B, Xi X, Chen D, Peng J; on behalf of China Critical Care Clinical Trial Group (CCCCTG): Clinical review: Critical care medicine in china mainland Crit Care 2010,...

Ngày tải lên: 13/08/2014, 20:21

2 270 0
Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt

Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt

... of “make shift measures” to urinate • Dehydration (not drinking fluids to prevent urination) Vaginal symptoms: Itching, burning, pain, & discharge Menstrual complaints: Pain, heavy bleeding, ... Does providing women with information on feminine • hygiene and menstrual self-care practices lead to a decrease in genitourinary complaints during deployment? Specific Aims  To increase knowledge ... vaginitis, UTIs, and menstrual symptoms during deployment This study has potential of significantly contributing to improving female Soldiers’ readiness and filling a gap in military health care...

Ngày tải lên: 13/02/2014, 07:20

18 734 0
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx

Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx

... 1245(-8.5) The values inside brackets are the rate of decrease 4.3 More Applicable for a Result Having a Few Errors In EPC+SSC, the rate of decrease was 8.5%, and the decrease was obtained in all type ... in the experiment) characters before and after an error-block in the Error-String, am found in the SimilarString, take out the string (denoted C) between A and B in For detecting errors in Japanese ... of the actual utterance (A) No lacking in the meaning of the actual utterance, and with perfect expression (B) No lacking in meaning, but with slightly awkward expression (C) Slightly lacking in...

Ngày tải lên: 20/02/2014, 18:20

5 588 0
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc

Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc

... milligram of the protein was loaded onto a preparative SDS-containing gel, according to Schagger et al [27], together with a prestained marker ¨ After the run, the c11 ring was visible, without staining, ... processing system (Synoptics Ltd, Cambridge, UK) Alternatively, the rotational power spectrum of each individual particle was calculated and then averaged (data not shown) It appeared that all averaged ... of these rings had gaps indicative of the absence of, in most cases, one c subunit [16] As these rings had the same diameter as the c11 rings, they were regarded as incompletely assembled In...

Ngày tải lên: 07/03/2014, 21:20

10 477 0
Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx

Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx

... in training data For simplicity of implementation, they are excluded from training data Note that the tagging rules can be used only for generating training data They cannot be used to distinguish ... taken into account in this paper, the feedback corpus contains further useful information For example, we can obtain training data consisting of instances of errors by comparing the feedback corpus ... chicken/mass for dinner where (4) ¢ £¡ (2) Now rules that match the template can be obtained from the training data All we need to is to collect words in from the training data Here, the words in Table...

Ngày tải lên: 23/03/2014, 18:20

8 502 0
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main focus of Qatar ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center...

Ngày tải lên: 18/06/2014, 19:20

8 375 0
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622, using...

Ngày tải lên: 20/06/2014, 01:20

4 451 0
w