a catholic alternative to embryonic stem cell research and adoption

Guidelines for Human Embryonic Stem Cell Research potx

Guidelines for Human Embryonic Stem Cell Research potx

... stem cells for purposes of standardization and for validation of results The safe handling and storage of blastocysts and stem cell material and conditions for transfer of such material among laboratories ... conduct the research in accordance with all applicable laws and guidelines pertaining to recombinant DNA research and animal care hES cell research leading to potential clinical application must ... for validation of results The safe handling and storage of blastocysts and stem cell material and the conditions for transfer of such material among laboratories Copyright © National Academy...

Ngày tải lên: 06/03/2014, 15:20

179 330 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 1

Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 1

... R: ggagccgtagtgagcagttc atgcctcacacggagactgt aagtgggttgtttgcctttg ggcacagttagagccaactaaga ccgagcagcactaacacg gagaggcagctgagatcagaa tgagaatacgatgtctgcaggt gtggagagcaactccgatg tctgcagagctttgatgtcc ... ggcacacacacattaacacactt ggtgtgtgagagcaattctcag aggtggttgaccttcaatgg tttgatttcttccagcattgtg gagtctgcctgttgcagga cagcgtctgacagcgaca aagttcaacaacaactgctaccaa gaagctcgtcatgcagttca ttgctgcctctttaagactagga ... agaaggagctgcgacaattc tccaaagtaggtgaccaagtcc gaccccaaggattacctcatt gttgatggcctccagtgac gcacacgttattcggatcg gcttgtcctccttctcgttc aactacgcgtttctccatgc aaagtgggcctttctccatc agccacatcgctcagacac gcccaatacgaccaaatcc...

Ngày tải lên: 09/09/2015, 17:54

83 381 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 3

Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 3

... al., 2010; Bond et al., 2009; Rapicavoli et al., 2010; Tochitani and Hayashizaki, 2008) LncRNAs are also dynamically expressed during neuronal-glia fate specification, and they appear to regulate ... and qPCR was performed to compute nuclear/cytoplasmic ratio HOTAIR and KCNQ1OT1 are well-characterized, nuclear-localized RNAs, while GAPDH and ACTB are proteincoding mRNAs expected to be cytoplasmically ... expression and specify neural cell fate specification   118  Figure 7.10: Apart from lncRNA_N2, the other neuronal lncRNAs were nuclearlocalized Cellular RNA was separated into the nuclear and cytoplasmic...

Ngày tải lên: 09/09/2015, 17:54

55 327 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 4

Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 4

... signal and the DAPI stain confirmed that RMST is a nuclear-localized lncRNA (Figure 8.11B) Figure 8.11: RMST is a nuclear-localized lncRNA (A) Cellular RNA was separated into the nuclear and cytoplasmic ... cytoplasmic fractions by RNA fractionation, and abundance of the RNA transcripts in either fraction was assayed by qPCR The nuclear/cytoplasmic ratio was computed presented in the graph (B) To confirm ... Lmx 1a expression on an adjacent midbrain section during E11.5 to 14.5 At E14.5, Rmst expression is largely restricted to the ventral tegmental area (VTA), and not the laterally located substantia...

Ngày tải lên: 09/09/2015, 17:54

13 275 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5

Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5

... Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator Genes Dev 20, 1470-1484 Ferri, A. L., Cavallaro, M., Braida, D., Di Cristofano, A. , Canta, A. , Vezzani, A. , Ottolenghi, ... Katayama, S., Tomaru, Y., Kasukawa, T., Waki, K., Nakanishi, M., Nakamura, M., Nishida, H., Yap, C.C., Suzuki, M., Kawai, J., et al (2005) Antisense transcription in the mammalian transcriptome ... dopaminergic differentiation of human embryonic stem cells induced by stromal cells Stem Cells Dev 19, 71-82 Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka,...

Ngày tải lên: 09/09/2015, 17:55

34 316 0
Dual roles of transcription factor zic3 in regulating embryonic stem cell pluripotency and differentiation

Dual roles of transcription factor zic3 in regulating embryonic stem cell pluripotency and differentiation

... transcription factor The amino acid sequence of a prototypical transcription factor is illustrated, containing a DNA-binding domain (DBD), a signal sensing domain (SSD), and a transactivation domain (TAD) ... The Nanog protein comprises a 96 amino acid N-terminal domain and a 150 amino acid C-terminal domain Both the N- and C-terminal domains of mouse Nanog have the ability to transactivate Nanog target ... initiated by Takahashi and Yamanaka have demonstrated the ability of four transcription factors Oct4, Sox2, Klf4 and c-Myc to re-establish a pluripotent state when ectopically expressed in mouse and...

Ngày tải lên: 11/09/2015, 09:02

271 283 0
The role of microRNAs in embryonic stem cell development and differentiation

The role of microRNAs in embryonic stem cell development and differentiation

... transcription factors Oct4, Sox2 and Nanog are known to play a central role in ESC maintenance and differentiation, and the levels and activity of these transcription factors are indicators of ESCs’ ... endodermal, ectodermal and mesodermal tissue and cell types (Evans and Kaufman, 1983); and ESCs (unlike EC cells) are able to participate fully in fetal development when reintroduced into an embryo ... signal transducer and activator of transduction) pathway and the Src homology (SHP2)-Erk pathway (Rao, 2004) Activation of the JAK-STAT pathway results in JAK-mediated phosphorylation of STAT3,...

Ngày tải lên: 12/09/2015, 08:16

192 377 0
Báo cáo sinh học: "Q&A: What can microfluidics do for stem-cell research" ppsx

Báo cáo sinh học: "Q&A: What can microfluidics do for stem-cell research" ppsx

... environments can be used to test the tolerance of cells to mechanical and shear forces, gases, oxidants and other extracellular cues that charac­ terize the disease environment Physical, mechanical and ... environment also allows investigators to perturb cell fate to generate desired outcomes, and to define the limits of physical, mechanical and biochemical factors that are tolerated by stem cells at different ... single cell, for example the apical versus basal signals that will be encountered by a polarized cell In traditional mass culture, cells align in random fashion, and although matrix coatings on tissue-culture...

Ngày tải lên: 06/08/2014, 19:21

3 294 0
Báo cáo y học: "A mouse embryonic stem cell bank for inducible overexpression of human chromosome 21 genes." ppsx

Báo cáo y học: "A mouse embryonic stem cell bank for inducible overexpression of human chromosome 21 genes." ppsx

... microarray data J Am Stat Assoc 2005, 100:764-780 29 Ishwaran H, Rao JS, Kogalur UB: BAMarraytrade mark: Java software for Bayesian analysis of variance for microarray data BMC Bioinformatics ... using a more sensitive statistical method than the standard t-test approach The method we selected was Bayesian analysis of variance for microarrays [27-29], a Bayesian spike and slab hierarchical ... on MAS5 normalized array data using the default settings except for the following parameters: accuracy was set to high, clustering was set to manual with a value of 25, and variance was set to...

Ngày tải lên: 09/08/2014, 20:22

18 460 0
Báo cáo y học: "A comparative analysis of DNA methylation across human embryonic stem cell lines" docx

Báo cáo y học: "A comparative analysis of DNA methylation across human embryonic stem cell lines" docx

... genes To be called a SNP, a locus had to have a coverage of at least eight reads, and a ratio between 0.5 and 0.6 for the major allele For each gene we calculated the probability that the major and ... regulatory motif sites Bioinformatics 2009, 25:167-174 Yoshida-Hata N, Mitamura Y, Oshitari T, Namekata K, Harada C, Harada T, Yamamoto S: Transcription factor, SP1, in epiretinal membranes of patients ... Clark V, Bird AP, Jaenisch R: NonCpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a Proc Natl Acad Sci USA 2000, 97:5237-5242 Aoki A, Suetake...

Ngày tải lên: 09/08/2014, 23:20

12 459 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

... to HIV/ AIDS, new and innovative approaches are essential [10,11] Gene therapy through intracellular immunization offers a promising alternative approach and possible supplement to current HAART ... representative hES colony and an cystic body respectively C and D, morphology of DCs differentiated from hES and FL derived CD34+ cells were stained with CD 1a and HLA-DR, CD 1a and B7.1, and CD 1a and ... T cell stimulation hES-DCs are capable of antigen uptake An essential function of the DCs is their ability to capture and present antigen to T-cells The capacity of DCs to take up antigens was...

Ngày tải lên: 10/08/2014, 05:20

9 261 0
Báo cáo y học: "A full menu for stem-cell research" pps

Báo cáo y học: "A full menu for stem-cell research" pps

... pattern will make this approach therapeutically relevant Cancer stem cells Self-renewal is the hallmark of both stem cells and cancer cells, and in his talk on leukemia stem cells, Weissman addressed ... between host hepatocytes and transplanted macrophages Further insight into the factors that govern in vivo cell fusion and the nature of reprogramming of the macrophage nucleus to a hepatocyte gene-expression ... Cossu (Stem Cell Research Institute, Milan, Italy) These cells are physically associated with vessels, coexpress early endothelial and myogenic markers, and are capable of differentiating into mesodermal...

Ngày tải lên: 14/08/2014, 14:21

2 156 0
A human embryonic stem cell based model of trophoblast formation

A human embryonic stem cell based model of trophoblast formation

... (Carosella et al., 200 8a; Carosella et al., 2008b) Trophoblast cells are also able to avoid maternal natural killer cell monitoring and attacking independent of HLA class I expression (Avril et al., 1999) ... soon after implantation Although they are able to form blastocysts and implant, development is arrested shortly after implantation due to a failure to continue to proliferate and differentiate ... fibroblasts to the pluripotent state (Takahashi and Yamanaka, 2006) The transcription factor Pou5f1 (aka Oct4) is expressed in mouse oocytes and in the preimplantation embryo At the blastocyst stage,...

Ngày tải lên: 11/09/2015, 16:07

205 261 0
SIMPLE OPEN ECONOMY MACRO WITH COMPREHENSIVE ACCOUNTING A RADICAL ALTERNATIVE TO THE MUNDELL FLEMING MODEL ppt

SIMPLE OPEN ECONOMY MACRO WITH COMPREHENSIVE ACCOUNTING A RADICAL ALTERNATIVE TO THE MUNDELL FLEMING MODEL ppt

... economies reach a quasi-stationary state in which all stocks and all flows including the stock of money not change at all – but there is a never ending purchase of Treasury Bills (and a growing stock ... rate of interest immediately raises the $ rate of exchange This disturbs the whole system by generating fiscal and trade imbalances The changing exchange rate eventually restores a steady state ... wealth and its allocation between the available assets and the exchange rate are all endogenously determined When the exchange rate changes, this changes the import propensity, disposable income and...

Ngày tải lên: 06/03/2014, 15:21

13 491 0
Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx

Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx

... (PTB) and its neural homologue (brPTB) in prenatal and postnatal mouse brain Mech Dev 101, 217–220 Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M & Yamanaka ... room temperature Cell cycle analysis was carried out using a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ, USA) and flowjo software (TreeStar, Ashland, OR, USA) Mice and teratoma formation C57BL ... Japan) Proliferation assay, apoptosis assay, and AP staining For the proliferation assay, · 105 cells were seeded in growth medium and counted every day over days of culture Viable and total cells...

Ngày tải lên: 07/03/2014, 00:20

11 454 0
The Case for Controlled-Atmosphere Killing of Poultry in Transport Containers Prior to Shackling as a Humane Alternative to Electrical Stunning doc

The Case for Controlled-Atmosphere Killing of Poultry in Transport Containers Prior to Shackling as a Humane Alternative to Electrical Stunning doc

... Detrimental to Welfare When inhaled, carbon dioxide has been shown to be highly aversive to humans (Gregory and others 1990) and birds Raj (199 8a) states that “[c]arbon dioxide is an acidic gas and ... in-plant Easyload system fitted with gas stunning; washer; automatic drawer loading and unloading is approximately 1.5 million USD” (Burgos 2003) Ian Taylor, sales director of American Autoflow ... “chickens can and inhale water during electrical stunning in a waterbath and that no remedy is available at the moment.” The authors suggest that the respiratory tract could, thus, be contaminated...

Ngày tải lên: 31/03/2014, 08:20

16 504 0
the mit press neither brain nor ghost a nondualist alternative to the mind-brain identity theory aug 2005

the mit press neither brain nor ghost a nondualist alternative to the mind-brain identity theory aug 2005

... and dynamical systems theory, he proposes a bold alternative to Cartesian materialism that deserves careful scrutiny." J A Scott Kelso, Glenwood and Martha Creech Chair in Science and Director, ... Complex Systems and Brain Sciences, Florida Atlantic University Of Related Interest: Communicative Action and Rational Choice Joseph Heath Paper / March 2003 Perspectives on Science: Historical, Philosophical, ... Brain nor Ghost - The MIT Press "A new view of mind is in the air Teed Rockwell has sensed it and articulated it beautifully in this book Using a powerful combination of Dewey's pragmatism and...

Ngày tải lên: 11/06/2014, 12:44

2 304 0
báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

... to be viable and uncontaminated To assure viability and sterility, a vial was recovered from the freezer and passaged times and then tested for mycoplasmal, bacterial and fungal contaminants Six ... keratinocytes Implications for normal and impaired wound healing J Biol Chem 1995, 270:12607-12613 Saaristo A, Tammela T, Farkkila A, Karkkainen M, Suominen E, YlaHerttuala S, Alitalo K: Vascular ... display cellular characteristics of senescence J Vasc Surg 1998, 28:876-883 Hasan A, Murata H, Falabella A, Ochoa S, Zhou L, Badiavas E, Falanga V: Dermal fibroblasts from venous ulcers are unresponsive...

Ngày tải lên: 18/06/2014, 15:20

9 487 0
w