a case study of southwestern cameroon

Tài liệu Carnivore Ecology and Conservation A Handbook of Techniques pptx

Tài liệu Carnivore Ecology and Conservation A Handbook of Techniques pptx

... topic, and I became one of his advisors That was all long ago, and the eld has advanced greatly and blossomed Now instead of merely locating an animal via telemetry (a feat in itself years ago), ... of Saskatchewan, 52 Campus Drive, Saskatoon, Saskatchewan, S7N 5B4, Canada E-mail: marc.cattet@usask.ca Paolo Ciucci Department of Biology and Biotechnologies, Sapienza Universit di Roma, Viale ... Ecology and Conservation: A Handbook of Techniques Adrian C Newton Habitat Management for Conservation: A Handbook of Techniques Malcolm Ausden Conservation and Sustainable Use: A Handbook of Techniques...

Ngày tải lên: 17/02/2014, 17:20

508 585 1
Carnivore Ecology and Conservation: A Handbook of Techniques pptx

Carnivore Ecology and Conservation: A Handbook of Techniques pptx

... topic, and I became one of his advisors That was all long ago, and the eld has advanced greatly and blossomed Now instead of merely locating an animal via telemetry (a feat in itself years ago), ... of Saskatchewan, 52 Campus Drive, Saskatoon, Saskatchewan, S7N 5B4, Canada E-mail: marc.cattet@usask.ca Paolo Ciucci Department of Biology and Biotechnologies, Sapienza Universit di Roma, Viale ... Ecology and Conservation: A Handbook of Techniques Adrian C Newton Habitat Management for Conservation: A Handbook of Techniques Malcolm Ausden Conservation and Sustainable Use: A Handbook of Techniques...

Ngày tải lên: 06/03/2014, 18:20

508 461 0
Báo cáo y học: "Pravastatin Provides Antioxidant Activity and Protection of Erythrocytes Loaded Primaqe"

Báo cáo y học: "Pravastatin Provides Antioxidant Activity and Protection of Erythrocytes Loaded Primaqe"

... presence and absence of PS 359 Materials and methods Materials Pravastatin sodium was gifted by Saudi Pharmaceutical Industries & Medical Appliances Corporation (SPIMACO, Al–Qassim, Saudi Arabia) Primaquine ... observation stated that pravastatin maintains catalase activity; however catalase is one of the important antioxidant enzymes in erythrocytes [29] The reduction of NPSH by primaquine is a clear ... thank Dr Gamal Harisa, Kayyali Chair for Pharmaceutical Industry, College of Pharmacy, King Saud University for his assistance Also, Dr Omar Abdel-Kader, SEM Unit, Zoology Department, College of...

Ngày tải lên: 25/10/2012, 11:40

8 537 0
Windows Home Server Protect and Simplify Your Digital Life

Windows Home Server Protect and Simplify Your Digital Life

... Vista’s Always Available Offline option Just right-click on any network folder and select the Always Available Offline option, and Vista’s Sync Center will automatically manage a local copy of all ... you may not have the latest copy of a file, or you may not have it available at all In multiuser homes, you may not always be able to use the same computer, and you can’t always plan in advance ... files take up significant space on your hard drive A typical image from a modest digital camera can take up megabytes of space, and photo aficionados that use the “raw” format on their cameras might...

Ngày tải lên: 01/01/2014, 16:48

311 394 0
Tài liệu Physical Activity and Women’s Health pptx

Tài liệu Physical Activity and Women’s Health pptx

... diseases that are major causes of death among black, Hispanic, and Native American/Alaskan Native women compared to white and Asian/Pacific Islander women TA BLE Ag e - a d ju st e d p r e v a ... activity and breast cancer From the National Health and Nutrition Examination Survey database (NHANES I), Albanes et al (1989) examined breast cancer incidence relative to baseline recreational and ... Health, 79, 744–750 American Diabetes Association (1992) Alexandria, VA American Diabetes Association (1990) Diabetes mellitus and exercise Position statement of the American Diabetes Association...

Ngày tải lên: 13/02/2014, 08:20

12 588 0
Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx

Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx

... Rey Juan Carlos, Madrid, Spain School of Public Health Madrid Spain 4Department of Physical Therapy, Occupational Therapy, Rehabilitation and Physical Medicine, Universidad Rey Juan Carlos, Alcorcón, ... 35 López-Garc a E, Banegas-Banegas JR, Gutiérraz-Fisac JL, Graciani PérezRegadera A, Díez Gañán L, Rodríguez-Artalejo F: Relation between body weight and health-related quality of life among the ... 338:b688 Ueshima K, Ishikawa-Takata K, Yorifuji T, Suzuki E, Kashima S, Takao S, Sugiyama M, Ohta T, Doi H: Physical activity and mortality risk in the Japanese elderly: a cohort study Am J Prev Med...

Ngày tải lên: 14/02/2014, 06:20

11 912 0
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

... secondary binding site to water-unextractable arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) and of A niger xylanase mutants to water-unextractable arabinoxylan (C) and oat spelt xylan (D) ... Ragunath C, Manuel SGA, Venkataraman V, Sait HBR, Kasinathan C & Ramasubbu N (2008) Probing the role of aromatic residues at the secondary saccharide-binding sites of human salivary alpha-amylase in ... Solubilization of water-unextractable arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) by B subtilis xylanase mutants with a modified secondary binding site and of water-unextractable arabinoxylan...

Ngày tải lên: 14/02/2014, 19:20

14 601 0
Tài liệu Báo cáo khoa học: Processing, catalytic activity and crystal structures of kumamolisin-As with an engineered active site pptx

Tài liệu Báo cáo khoa học: Processing, catalytic activity and crystal structures of kumamolisin-As with an engineered active site pptx

... Wlodawer A, Li M, Gustchina A, Tsuruoka N, Ashida M, Minakata H, Oyama H, Oda K, Nishino T & Nakayama T (2004) Crystallographic and biochemical investigations of kumamolisin-As, a serine-carboxyl ... mutant showed a small increase in its peptidase activity at neutral pH The kcat values at neutral pH were 7–8 times higher than the values at acidic pH, displaying an apparent pKa of FEBS Journal ... that of serine peptidase catalysis Unlike the case of Asp164Ala substitution in kumamolisin, a low but appreciable level of catalytic activity was found with the purified D164N mutant of kumamolisin-As...

Ngày tải lên: 19/02/2014, 07:20

14 458 0
Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx

Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx

... TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG The annealing site for the upstream primer corresponds to 12 amino acids before the protease sequence ... interaction range of the partially charged Cf carbon of the arginines The presence of an electrostatic interaction is supported by quantum mechanical calculations of the partial charges for Cf carbon ... calculated with a maximum distance of 3.2 A between acceptors and donors d An atom-pair ˚ distance of less then 3.5 A between atom with same polarity was used as a criterion for a repelling contact...

Ngày tải lên: 19/02/2014, 16:20

9 560 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

... T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) ... SDS/PAGE analysis After 24 h, the fraction of molecules behaving as a substrate for uPA decreased approximately twofold for PAI-1(V12 6A) , PAI-1(F10 0A) , PAI-1(F12 8A) and PAI-1(W14 1A) with a concomitant ... rate of latency transition expressed as the functional half-life, t½ The averages and standard deviations for at least three independent measurements are given for each variant PAI-1 variant Activity...

Ngày tải lên: 20/02/2014, 11:20

9 606 0
Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc

Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc

... 1) and from 27-month-old rats (lane 2) Standard molecular masses (lane 3) The arrow and arrowhead show the disappearance and appearance of bands, respectively Ó FEBS 2003 2300 H Bakala et al ... for 30 at 37 °C The absorbance (A) was measured at 405 nm on a micro-ELISA plate reader (Spectra Rainbow, SLT Labinstruments, Austria) Results are expressed as the ratio B/B0, calculated as [experimental ... Miyata, T., Inagi, R., Asahi, K., Yamada, Y., Horie, K., Sakai, H., Uchida, K & Kurokawa, K (1998) Generation of protein carbonyls by glycoxidation and lipoxidation reactions with autoxidation...

Ngày tải lên: 20/02/2014, 11:20

8 413 0
Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

... (A) 0.1 M NaOH and (B) M NaOAc in 0.1 M NaOH and a gradient from 30% to 70% of eluent B in 16 at a flow-rate of mLÆmin)1 desalted by gelfiltration In analytical HPAEC one major oligosaccharide as ... particular at low concentrations Discussion Members of the Gram-negative bacterial family Chlamydiaceae cause diseases in man such as ocular trachoma and infections of the genitourinary tract of men ... deacylated sample was desalted by gelfiltration on Sephadex G10 in NH4HCO3 and lyophilized three times Analytical HPAEC The deacylated LPS was analysed by analytical highperformance anion exchange...

Ngày tải lên: 20/02/2014, 23:20

11 560 0
Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... stability (DGD°, Gibbs free energy change at 25 °C) of RNase -A and its activity parameters (Km, Michaelis constant; kcat, catalytic constant) in the presence and absence of almost all naturally ... thermodynamic activity of substrates and enzymes [13,30,31] Thus, a lack of effect on both enzymatic parameters (Km and kcat) of RNase -A suggests that polyols, amino acids and amino acid derivatives ... We have therefore measured the thermodynamic parameters of RNase -A in the presence of these amino acids and amino acid derivatives, and values of DGD°, measured in triplicate, are given in Table...

Ngày tải lên: 07/03/2014, 00:20

9 547 0
Báo cáo khoa học: Haptoglobin binds the antiatherogenic protein apolipoprotein E – impairment of apolipoprotein E stimulation of both lecithin:cholesterol acyltransferase activity and cholesterol uptake by hepatocytes pdf

Báo cáo khoa học: Haptoglobin binds the antiatherogenic protein apolipoprotein E – impairment of apolipoprotein E stimulation of both lecithin:cholesterol acyltransferase activity and cholesterol uptake by hepatocytes pdf

... Coomassie-stained bands of isolated Hpt (lane 1), standard ApoE (lane 2), standard ApoA-I (lane 3), and partially purified Hpt from Hb–Sepharose (lane 4) Molecular mass markers (BSA, 66 kDa; ovalbumin, 45 kDa; ... the Coomassie-stained bands This Hpt preparation contained small amounts of ApoA-I and ApoE, and was free of albumin and other protein contaminants Isolation of Hpt for in vitro assays and cell ... triplicate, and the datum was expressed as mean value ± standard error of the mean (SEM) The program graph pad prism (Graph Pad Software, San Diego, CA, USA) was used to obtain trend curves and...

Ngày tải lên: 07/03/2014, 00:20

14 445 0
Báo cáo khoa học: Simultaneous improvement of catalytic activity and thermal stability of tyrosine phenol-lyase by directed evolution ppt

Báo cáo khoa học: Simultaneous improvement of catalytic activity and thermal stability of tyrosine phenol-lyase by directed evolution ppt

... process Aligning each mutation against the sequences of A1 A4 and S1–S3 allowed the parental origin of the mutations to be estimated For example, AS4, composed of A1 3V, E83K and T45 1A, was analyzed ... Geobacillus spp Appl Environ Microbiol 72, 1588–1594 Hoseki J, Okamoto A, Takada N, Suenaga A, Futatsugi N, Konagaya A, Taiji M, Yano T, Kuramitsu S & Kagamiyama H (2003) Increased rigidity of ... restriction endonucleases, T4 DNA ligase and Vent DNA polymerase were purchased from New England Biolabs (Beverly, MA, USA), and the Taq DNA polymerase was obtained from Takara (Otsu, Japan) The oligonucleotides...

Ngày tải lên: 07/03/2014, 00:20

8 429 0
Báo cáo khoa học: Hyperthermophilic enzymes ) stability, activity and implementation strategies for high temperature applications pot

Báo cáo khoa học: Hyperthermophilic enzymes ) stability, activity and implementation strategies for high temperature applications pot

... xylan-degrading strain of Sulfolobus solfataricus: isolation and characterization of the xylanase activity Extremophiles 8, 117–124 48 Takagi M, Nishioka M, Kakihara H, Kitabayashi M, Inoue H, Kawakami ... thermal denaturation of DNA: average length and composition of denatured areas Nucleic Acids Res 1, 959–978 12 Musto H, Naya H, Zavala A, Romero H, AlvarezValin F & Bernardi G (2004) Correlations ... family-57-like alpha-amylase of Methanococcus jannaschii Folia Microbiol 46, 467–473 88 Rudiger A, Jørgensen PL & Antranikian G (1995) Iso¨ lation and characterization of a heat stable pullulanase from...

Ngày tải lên: 07/03/2014, 05:20

13 468 1
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... currently aimed at achieving a detailed understanding of the roles of the numerous components of the MVB sorting machinery Vps4 is an ATPase of the AAA (ATPase associated with a variety of cellular activities) ... CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype Source EGY48 AMY245 MATa his3 trp1 ura3 LexAop(·6)-LEU2 MATa vps4-D::KanMx leu2 ura3 his4 lys2 bar1 MATa...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... cells, and this transformant was plated onto a lm paraquat plate so as to obtain approximately 4000 transformants The growth (or lack of growth) of these Q14 3A hMnSOD-expressing cells on lm paraquat ... enhance activity, this replacement in the double mutant N73S–Q14 3A causes an increase in catalysis (Table 2) Based on the kinetic data in Table and an analysis of the X-ray crystal structure of ... from an agarose gel and purified For both standard and error-prone PCR amplification of hMnSOD genes, the following primers were used: hMnSOD5B, 5¢-CACAGGAAACAGATCATGAAG-3¢; and hMnSOD3P, 5¢-CAAGCTTGCATGCCTGCAGT-3¢...

Ngày tải lên: 07/03/2014, 11:20

9 416 0
Báo cáo khoa học: Alpha-fetoprotein antagonizes X-linked inhibitor of apoptosis protein anticaspase activity and disrupts XIAP–caspase interaction ppt

Báo cáo khoa học: Alpha-fetoprotein antagonizes X-linked inhibitor of apoptosis protein anticaspase activity and disrupts XIAP–caspase interaction ppt

... the association between XIAP and activated caspase 3, and antagonizes the antiapoptotic function of XIAP Our data indicated that AFP could also bind free XIAP to eliminate it from the reaction area ... cytosol as inactive zymogens and are activated via a proteolytic cascade started by the initiator caspases [5] Molecular pathways leading to apoptosis are evolutionarily conserved and are regulated ... blotting of pellets using antibodies against caspase and caspase demonstrated that neither AFP nor HSA was able to modulate binding of His-tagged caspases on the nickel resin (Fig 3) The data clearly...

Ngày tải lên: 07/03/2014, 12:20

13 445 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

... AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ... AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ... AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGGGCTACTTCACTCAAAG 44/750...

Ngày tải lên: 07/03/2014, 15:20

9 415 0

Bạn có muốn tìm thêm với từ khóa:

w