a case study for sustainable use and development
Tài liệu Báo cáo " Climate change adaptation from small and medium scale hydropower plants: A case study for Lao Cai province " doc
... a total installed capacity of 721.3 MW (80%) and an average annual energy production of 2,816 GWh (72%), would in that case be economically viable [3] b) Water allocation and conflicting demands ... upstream, near the construction sites and near roads to the hydropower plants can be losing because of land loss, degradation of natural resources, and impacts on water and air environment Although ... relative to the present hydrological conditions is larger, and it is estimated at 7.7% for 2030 and 12.1% for 2050 for Scenario B1, 6.3% for 2030 and 10.1% for 2050 for Scenario B2, and 6.2% for...
- 9
- 546
- 0
Adoption and Impacts of Improved Maize Production Technology: A Case Study of the Ghana Grains Development Project pot
... Wa Guinea savannah Northern Salaga Damongo Walewale Guinea savannah Guinea savannah Guinea savannah Brong Ahafo Nkoranza Transition Ashanti Sekyere West Adansi East Amansie West Transition Forest ... Shivaji Pandey, Prabhu Pingali, Walter Falcon, and David Poland of CIMMYT; and Nana Koranteng and Mark Mostovac of CIDA-Ghana Helpful comments were also contributed by Diana McLean of CIDA-Canada ... Forest Western Dorma-Ahenkro Sefwi Wiaso Mpohor-Wassa Forest Forest Forest Central Gomua-Assin-Ajumako Agona Coastal savannah Coastal savannah Eastern Suhum Kraboa Yilo Krobo West Akim Fanteakwa...
- 46
- 753
- 0
Báo cáo hóa học: "Setup, efforts and practical experiences of a monitoring program for genetically modified plants - an Austrian case study for oilseed rape and maize" pptx
... which is used as the standard reference grid for all spatial statistic data in Austria Hence, we have a direct spatial link between our BINATS test areas and a wide range of socioeconomic and agronomic ... related species were considered for the calculation: Brassica elongata, B juncea, feral B napus, B nigra, feral B oleracea, wild and feral B rapa, Conringia austriaca, C orientalis, Crambe tatarica, ... this article as: Pascher et al.: Setup, efforts and practical experiences of a monitoring program for genetically modified plants an Austrian case study for oilseed rape and maize Environmental...
- 12
- 497
- 0
A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy
... pregnancy There was a significant further advance of her renal disease, necessitating the initiation of haemodialysis (a kidney machine) two years later, and a living, related donor renal transplant ... was complicated at 20 weeks’ gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation with heparin and warfarin was required Spontaneous rupture ... renal damage reported a prematurity rate of 17 per cent and a spontaneous abortion rate (miscarriage) of 20 per cent, as compared to 163 164 G.M Lockwood prematurity and spontaneous abortion rates...
- 6
- 512
- 0
Tài liệu Báo cáo khoa học: "Acquiring Lexical Generalizations from Corpora: A Case Study for Diathesis Alternations" pdf
... correctly alternate (cause, deliver, hand, refuse, report and set for the dative alternation and cause, spoil, afford and prescribe for the benefactive), and 12 can appear in either frame but not alternate ... acquired 68 for the dative and 43 for the benefactive alternation (in both cases including verbs for which only one frame was acquired) The dative and benefactive alternations were also acquired for ... author was supported by the Alexander S Onassis Foundation and the UK Economic and Social Research Council Thanks to Chris Brew, Frank Keller, Alex Lascarides and Scott McDonald for valuable comments...
- 8
- 483
- 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
- 7
- 404
- 0
báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc
... of Patient A and B was 42 and 58, respectively The scores indicate that the Patients need for maximal or moderate assistance for achieving an adequate performance of ADL As the common clinical ... performed the design of this study, acquisition and analysis of data and drafting the manuscript SS made substantial contribution to acquisition and analysis of the data T Ifukube and T Izumi were involved ... Teine-ku, Sapporo, Japan and 3Department of Human Science and Informatics, School of Biological Science and Engineering, Tokai University, 5-1 Minamisawa, Minami-ku, Sapporo, Japan Received: 14 April...
- 8
- 538
- 0
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
- 7
- 566
- 0
Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx
... decreased, ECT treatment was stopped and clozapine was started on the 28/9/01, and gradually titrated upwards monitoring her mental state and side effects A BPRS rating scale performed four days ... her rapists saying derogatory comments to her The patient's mirtazapine, chlorpromazine and olanzapine medication were stopped and she was started on haloperidol and amitriptyline Two days later, ... outcome in a randomized 1-year trial of clozapine versus treatment as usual for patients with treatment-resistant illness and a history of mania Am J Psychiatry 1999, 156(8):1164-9 Ranjan R, Meltzer...
- 6
- 495
- 0
Internationnal payment A case study of freight forwarding and logistics companies in Vietnam Luận văn thạc sĩ
... Switzerland, Singapore, Australia, Korea, Hong Kong, China, Taiwan, Japan, Thailand, Indonesia, Malaysia, Pakistan, United Arab Emirates, making effective response rate 100% Finally, we have taken short ... will save time and costs, also being safe for small and regular inbound and outbound merchandises, especially for small air cargo, scare and perishable goods, samples… By getting feedback from ... Belgium, Australia, Korea, Hong Kong, China, Taiwan, Japan, Thailand, Indonesia, Malaysia, Pakistan, United Arab Emirates and luckily get 100% response from them 73.33% of participations accept this...
- 100
- 677
- 0
Determinants of customer loyalty in retail banking a case study of BIDVs branches and transaction offices in lam dong province
... Overall satisfaction CSA1 Fulfilled demand CSA2 Comparison Ideal bank Machine service quality Functional performance Technical performance Behavioral service quality Service transaction accuracy ... Soureli (2006), Jamal & Anastasiadou (2009), Afsar et al (2010) Customer are generally satisfied with a bank A bank fulfills the customer‟s demand A bank gains more satisfaction than others from ... Measurement The measurement service quality allows for comparison before and after changes and the establishment of clear standards for service quality Edvardsen et al (1994) stated that the starting point...
- 134
- 553
- 1
Protection of coral reefs for sustainable livelihoods and development the experience of Vietnam
... resevative areas and coastal ecosystems, such as coral reef ecosystem and mangrove forest ecosystem - Developing eco-tourism based on reservative activities, and promoting propaganda, awareness raising ... biodiversity; capacity and commitment for implementing policies; as well as natural resources management of local communities Coral reefs and sustainable development Coral reefs and related ecosystems ... environment and coastal ecosystems, etc), protecting livelihoods of coastal population especially the poor Coral reef degradation threatens livelihood of coastal population and sustainable development along...
- 5
- 390
- 1
Protection of coral reefs for sustainable livelihoods and development
... that have been designed to protect and manage coral reefs as part of an overall effort to enhance the sustainable development of marine and coastal areas A United Nations Member states at the ... cold water coral reefs are also extremely vulnerable to physical damage caused by human acitivity Bottom fishing and deep sea trolling have already caused and continue to cause severe impacts and ... ports and marinas; (3) designating safe shipping lanes and boating areas, including declaring “Particularly Sensitive Sea Areas (PSSA)” and (4) efficiently managing offshore oil and gas activities...
- 26
- 258
- 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx
... Klabin and Aracruz that present data for years 2003, 2004 and 2005 and Cenibra which data are available only for 2005 ** The companies not have this value calculated All plants, excepting Aracruz and ... performance; and they can contribute to the human capital formation for the sector International Standart Organization - ISO Forest Stewardship Council - FSC The Brazilian Association for Pulp and Paper ... and former President of the Brazilian Society for Ecological Economics She has published widely on trade and sustainable development and has served as a consultant and advisor to the Brazilian...
- 23
- 894
- 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf
... (Ground data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in the watershed area 17 Suggestion zones for sustainable of watershed ... landscape in the study area has been changed cause of policy implementation such as rubber plantation and irrigation system were installed in the area, and than this place was changed in dynamics ... watershed land use planning by created land zoning Materials and Methods Materials • • • • Satellite images: – Landsat ETM+ (25 January 1999), LIG format • Resolution – 30 m (band 1-5,7) – 15 m panchromatic...
- 24
- 897
- 0
Development of a robotic nanny for children and a case study of emotion recognition in human robotic interaction
... teachers, and can be employed for animal-assisted therapy (AAT) and animal-assisted activities (AAA) instead of real animals [2] This can partly reduce working strength of the staff, activate learning ... Facial A ect (POFA) databases have shown that the combination of AdaBoost as a feature selection method, SVM as a classification algorithm, and voting as a multiclass decision strategy can obtain ... shown that in human face-to-face communications, 7% and 38% information are transferred by spoken language and paralanguage, and 55% is transferred by facial expressions, we select facial expressions...
- 172
- 452
- 0
Industrial design strategies for sustainable development a case study of the packaging industry in singapore
... goals of the Singapore Packaging Agreement.” 3R Packaging Awards 2008 Communication Folder The Singapore Star Award The Asia Star Awards are organised annually by the Asian Packaging Federation ... plans for the continuous development of the country It was created in January 2008 to formulate a national strategy for Singapore’s sustainable development regarding domestic and global challenges ... environment) and green (preserving greenery, waterways and our natural heritage) (URA, 2008) “I want to develop Singapore in a sustainable way so that future generations of Singaporeans can also enjoy...
- 136
- 756
- 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
... at the stage of planning and implementation of water and sanitation options Educational intervention on water and sanitation: 1995-1997 The educational intervention on water and sanitation was ... pollution load to the surrounding water bodies such as a canal and ponds It was partly because the people had considered the biogas plant as maintenance free and they did not any maintenance at all with ... in Bauniabad, staffs of Dhaka Water and Sewerage Authority, staffs of EPRC and all the stakeholders for their kind cooperation and contribution to the study REFERENCES Bangladesh Bureau of Statistics...
- 9
- 971
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25