... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... accumulated heat releases in the adiabatic case is larger than the other cases thus, the amount of burnt fuel in this case is more than the others Because of shortage of oxygen in the charge of cylinder...
Ngày tải lên: 05/09/2013, 16:11
... tons/year (3) Transparency, access to information and proactive information dissemination on both positive and negative impacts of the projects from the investor and the provincial and local authorities ... (targeted and others), and to assess the overall result anticipated by each of the main transmission channels which are: prices, employment, transfers, access, authority and assets Important aspects of ... and Atmospheric-Ocean Global Circulation Models, are used to assess climate change impacts in Lao Cai Province, namely: Baseline scenario using the historical data and simulating the climate...
Ngày tải lên: 13/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Acquiring Lexical Generalizations from Corpora: A Case Study for Diathesis Alternations" pdf
... percentages are the average of the judges' individual classifications 399 in the case of the 'V NPI to NP2' structure, the to-PP must be an argument of the verb; in the case of the 'V NPI for NP2' ... productivity of an alternation for a given semantic class and the typicality of its members Acknowledgments The author was supported by the Alexander S Onassis Foundation and the UK Economic and Social ... underlying assumption is that a verb is typical for an alternation if it is equally frequent for both frames which are characteristic for the alternation Thus the typicality of a verb can be defined as...
Ngày tải lên: 20/02/2014, 19:20
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ... TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG Location* Length GC % Tm(°C) Amplicon ... WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ... TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG Location* Length GC % Tm(°C) Amplicon ... WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
... quite satisfactorily the estimation of N PARTICULAR CASE OF A LINEAR PIECEWISE VARIATION OF THE AUTOCORRELATION MATRIX EIGENVALUES The theoretical validity of this criterion will be demonstrated ... to a high-resolution radar application The goal is to find the most accurate estimate of the range profile of a radar target using its complex signature in the frequency domain An Estimation of ... classes An analytical demonstration is provided for a special case of a piecewise linear variation of the autocorrelation matrix eigenvalues Although this model is very simple, it contains all...
Ngày tải lên: 23/06/2014, 01:20
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pot
... such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, the United ... you look at the myriad relationships that your company has, or rather that you and your colleagues have, and evaluate whether they are adding value? Because the foundation of collaborative business ... physically across the table in the same room For others, collaboration is about the free flow of information across boundaries And for still others, it is the sharing of resources and goals More...
Ngày tải lên: 28/06/2014, 08:20
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf
... such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, the United ... you look at the myriad relationships that your company has, or rather that you and your colleagues have, and evaluate whether they are adding value? Because the foundation of collaborative business ... physically across the table in the same room For others, collaboration is about the free flow of information across boundaries And for still others, it is the sharing of resources and goals More...
Ngày tải lên: 28/06/2014, 22:20
Báo cáo khoa học: "A pilot study to assess the feasibility of evaluation of markers of response to chemotherapy at one day & 21 days after first cycle of chemotherapy in carcinoma of breast: a prospective non-randomized observational study" potx
... discretion of the treating physicians The study pathologist carefully evaluated the definitive surgical specimen for the presence of residual disease and grading of pathological response to chemotherapy ... statistically Non-parametric tests were applied to assess the other variables Patient baseline characteristics, the treatment regimen, and molecular markers were each assessed for an association ... cycle in the PPR group and then had a plateau to nearly same level at 21 days (Figure 2c) Caspase-3 values peaked at 24–48 hours before falling to near baseline levels at 21 days after the first...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf
... Â Animal Sire Dam Genotype Qi di 0 0 A A1 A A2 A A2 A A2 A A1 A A2 A A2 Table I Example pedigree and the corresponding Q i and di matrices 157 Gametic relationship matrix inverse The rationale ... separately The objective of the present paper is to develop a rapid method to obtain the inverse of the covariance matrix of the additive effects of a marked QTL in the case of complete marker ... 1995) The current techniques are still useful for the case of one unidentied parent and the case of incomplete marker data in general For instance, if d is a phantom parent of i, the most probable...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa hoc:" A sampling method for estimating the accuracy of predicted breeding values in genetic evaluation" potx
... Validation of this method was done in a sub-sample of the data used on the French on-farm evaluation, IBOVAL, for the Parthenaise breed The trait analysed was the muscular development score at ... empirical variances and covariances without actually computing all the other off-diagonal elements of the matrices NAG subroutines were used for drawing random numbers [22] 2.3 Validation of the ... where A is the numerator relationship matrix, and the scalars a and e are the additive and residual variance components, respectively The BLUP (Best Linear Unbiased Prediction) of the breeding values...
Ngày tải lên: 09/08/2014, 18:21
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 2 ppsx
... plummeting valuations, and soaring layoffs Others have a sense of the association and are trying to see their way clear Not all of the economic malaise of the years 2000 to 2002 is due to these two ... rather that you and your colleagues have, and evaluate whether they are adding value? Because the foundation of collaborative business lies not in the technical tools for communication and information ... of the favorite expressions of Guy Kawasaki, founder and CEO of Garage Technology Ventures (formerly called Garage.com) and former chief evangelist of Apple Computer: “There’s marketing and then...
Ngày tải lên: 10/08/2014, 11:20
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx
... Community are similar to those required of a choreographer of dance Encyclopaedia Britannica describes choreography as the gathering and organization of movement into order and pattern The choreographic ... that interact with each other in a mutually beneficial and personal manner As we’ve said, traditional industry structures are vestiges of another era that are in the process of dying 2 ❘ Collaborative ... store, as a cornerstone of the community, has really brought the whole area to life So what is his interest in having us there? Before our machine was there, there was a gumball machine and hair care...
Ngày tải lên: 10/08/2014, 11:20
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 4 ppt
... internal collaboration initiatives because of (1) an organizational structure that creates silos; (2) the inability to get people to see the value of collaboration; and (3) the lack of a culture and ... understand they can’t win customers by offering the lowest price, nor can they afford the kind of marketing and advertising that would make their name as well known as that of many of their competitors ... product and competencies for access to customers—that is, the members of the organization In addition, the organization offers actual 66 Part One ❘ The Era of Collaborative Business validation as...
Ngày tải lên: 10/08/2014, 11:20
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 5 pdf
... services at a reduced rate to tenants in Max’s buildings And Dave and Myer have agreed that after a trial period to assess tenants’ interest, they will pay Max a fee for each tenant that becomes their ... to the farm and more members to the organization And similar to a transactional relationship, a relationship in the collaborative quadrant is viable because it is a win-win for both parties Thus, ... relationship with the landlord of space you rent as transactional On the first of every month you send the landlord a check, and the landlord makes sure you have occupancy of the rented space as...
Ngày tải lên: 10/08/2014, 11:20
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 6 potx
... goals and the currencies required for achieving them The final components of the Relationship Scorecard are the Weighted Totals and the Relationship Value (RV) The Weighted Totals are the calculated ... time after we take a closer look at what each of these nine relationship scenarios means: Scenario A: Collaborative Relationship A relationship that has a continuous bidirectional flow of currencies ... be, transactional Transactional relationships are a viable state and for many relationships are exactly suited to their purpose because they consume so few resources THE RELATIONSHIP DANCE Throughout...
Ngày tải lên: 10/08/2014, 11:20
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 7 ppt
... fair behavior by the other party and acceptance of the other party’s rights and interests The creation of shared goals and strategy, especially in the initial stage of a relationship, facilitates ... by Kasper-Fuehrer and Ashkanasy in the May 2001 issue of the Journal of Management, trust results from experiencing fair behavior by the other party together with acceptance of the other party’s ... directions, and as such each party needs to trust the other party or otherwise the information required for the collaboration won’t be shared LEVELS OF COLLABORATION To get a better understanding of the...
Ngày tải lên: 10/08/2014, 11:20