a case control study and literature review
Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt
... BMI for a comparison between individuals with high and average weight Participants gave informed consent and local Ethical Committee approval was obtained for the study Design and measures The present ... Results An initial exploratory analysis involved calculation of means and standard deviation for age, gender and BMI Differences between the groups were tested using Kruskall-Wallis nonparametric ... was established as a cross-sectional case- control study Subjects' BMI was calculated as weight in kilograms divided by the square of height in meters Binge eating status was assessed through a...
- 4
- 331
- 0
Báo cáo y học: "Regulatory polymorphisms in extracellular matrix protease genes and susceptibility to rheumatoid arthritis: a case-control study" ppsx
... Acknowledgements We thank sample donors for their collaboration and Drs Antonio Mera, Manuel Caamaño, Jorge Blanco and Santos Insua for providing access to their patients Lorena Fernandez-Blanco ... in a recent meta-analysis [24] Finally, population stratification, another widely claimed cause of spurious association results, is not a significant concern in this study as all cases and controls ... Constantin A, Lauwers-Cances V, Navaux F, Abbal M, van Meerwijk J, Mazieres B, Cambon-Thomsen A, Cantagrel A: Collagenase1 (MMP-1) and HLA-DRB1 gene polymorphisms in rheumatoid arthritis: a prospective...
- 7
- 360
- 0
Báo cáo y học: "Association of functional variants of PTPN22 and tp53 in psoriatic arthritis: a case-control study" docx
... mean age at onset of the study was 49.7 years The mean age at onset of psoriasis was 29.3 years (standard deviation 14.2 years) and the mean age at onset of PsA was 38.1 years (standard deviation ... consent was obtained from all patients All PsA probands were Caucasians Information was collected systematically and included age at onset of psoriasis and PsA, and disease pattern The control ... mean age at onset of psoriasis was 26.8 years (standard deviation 12.1 years) and the mean age at onset of PsA was 33.0 years (standard deviation 10.8 years) Forty-four per cent of the PsA patients...
- 3
- 324
- 0
Báo cáo y học: "Serum proteins and paraproteins in women with silicone implants and connective tissue disease: a case–control study" pot
... immunofixation electrophoresis method involving the use of Paragon Blue stain (Paragon; Beckman-Coulter, Brea, CA, USA) Statistical analyses Data are shown as the mean ± standard deviation Statistically ... GA, USA), immunofixation was performed first with a mixture of antibodies (anti-α, anti-γ, and anti-μ heavy chains, and anti-κ and anti-λ free light chains) (Penta screen; Sebia, Norcross, GA, ... paraproteins and/ or possible conversion into MM Erella, and the statistical assistance of Dr James Malley, Dr Karen Malley, and Dr Robert Wesley They thank Dr Sahar Dawisha, Dr Gregory Dennis, and Dr Nadja...
- 10
- 350
- 0
Báo cáo y học: "Cardiovascular risk factors and acute-phase response in idiopathic ascending aortitis: a case control study" pptx
... case/ control status and cardiovascular risk factors was examined by means of logistic regression models Each cardiovascular risk factor was examined individually and after adjustment for gender Analyses ... ESR and CRP measurements in the cases and controls are presented in Table ESR was determined in 13 cases and 22 controls The median values were 20 mm/ hour in cases and mm/hour in controls Among ... G, Nakazawa T, Morinobu A, Kumagai S: Impact of smoking as a risk factor for developing rheumatoid arthritis: a meta-analysis of observational studies Ann Rheum Dis 2009 in press Sakalihasan N,...
- 6
- 366
- 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... validation studies within a second independent French Caucasian family cohort and a case- control cohort of German Caucasian origin Association analysis within the second and combined first and...
- 11
- 460
- 0
báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt
... 5’TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ACTGTCAATCAAATGTGATTA3’ LV- COX-2siRNA-3 Oligo1: 5’TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT AGAGAAGGTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT AGGAGAGGTTAGAGAAGGTTA3’ ... 5’TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA GTATGTAGTGCACTGTGTTTA3’ LV- COX-2siRNA-2 Oligo1: 5’TaaTCACATTTGATTGACAGTCCAtcaagagTGGACTGTCAATC AAATGTGA TTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ... http://www.jeccr.com/content/30/1/26 Page of Table Interfering sequence specified for COX-2 gene Sequence LV-COX-2siRNA-1 Oligo1: 5’TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG CACTGTGTTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA...
- 9
- 373
- 0
Báo cáo y học: " Histology of adipose tissue inflammation in Dercum’s disease, obesity and normal weight controls: a case control study" doc
... autoimmune disease Case reports have shown that markers for autoimmune disease, such as rheumatoid factor (RF), antinuclear antibodies (ANA), anticardiolipin antibodies (ACA), perinuclear anti-neutrophil ... (Table 2) demonstrated an inflammatory reaction (I-III) with lymphocytes and macrophages (Figures 1, Page of and 3) An inflammatory reaction judged as I can be seen in Figures and and II in Figure ... juxta-articular adiposis dolorosa Arch Dermatol 1991, 127:231-233 13 Bonatus TJ, Alexander AH: Dercum’s disease (adiposis dolorosa) A case report and review of the literature Clin Orthop Relat Res...
- 6
- 403
- 0
Histology of adipose tissue inflammation in Dercum’s disease, obesity and normal weight controls: a case control study pdf
... autoimmune disease Case reports have shown that markers for autoimmune disease, such as rheumatoid factor (RF), antinuclear antibodies (ANA), anticardiolipin antibodies (ACA), perinuclear anti-neutrophil ... (Table 2) demonstrated an inflammatory reaction (I-III) with lymphocytes and macrophages (Figures 1, Page of and 3) An inflammatory reaction judged as I can be seen in Figures and and II in Figure ... juxta-articular adiposis dolorosa Arch Dermatol 1991, 127:231-233 13 Bonatus TJ, Alexander AH: Dercum’s disease (adiposis dolorosa) A case report and review of the literature Clin Orthop Relat Res...
- 6
- 268
- 0
Báo cáo y học: "Familial liability, obstetric complications and childhood development abnormalities in early onset schizophrenia: a case control study" pptx
... Results a) Demographic and clinical features of cases and controls The main demographic features of cases and controls are resumed in table In the study sample there were cases of EOS and 16 cases ... CBCL [11] A comprehensive diagnostic assessment was made in both cases and controls, including a physical, neurological and psychological examination and an instrumental Page of evaluation by ... (1H-MRS) showed an elevated lipids peak in both frontal regions with normal values of N-acetylaspartate (NAA), creatine plus phosphocreatine (Cr) and choline (Cho) and NAA/Cr and Cho/Cr ratios; the...
- 7
- 368
- 0
báo cáo khoa học: " The association of aggressive and chronic periodontitis with systemic manifestations and dental anomalies in a jordanian population: a case control study" pdf
... this case- control study consisted of 262 individuals and included 100 CP cases, 81 AP cases and 81 controls There were 125 males and 137 females with an age range of 14-71 years and a mean age ... distolingual/palatal) Inter-examiner reliability was calculated using alpha statistics with regard to probing depth and CAL on 16 quadrants Diagnosis of CP and AP was based on CAL values and confirmed radiographically ... http://www.head-face-med.com/content/6/1/30 Page of Table HAD Scale for Anxiety and Depression among the study population Variables CP AP Controls Table Dental Anomalies in CP and AP Dental Anomaly Site CP AP Controls No (% )a P values...
- 8
- 289
- 0
báo cáo khoa học:" Lack of association between celiac disease and dental enamel hypoplasia in a case-control study from an Italian central region" pdf
... Sangianantoni A, D'Angio F, Santarelli A, Lo Muzio L: Oral aphthous ulcers and dental enamel defects in children with coeliac disease Acta Paediatr 2006, 95(2):203-207 Majorana A, Sapelli PL, Malagoli ... Paediatric Department of the University Politecnica of Marche (Ancona, Italy), and the diagnosis of CD was based on serological tests (Ab-htTG IgA, Ab-htTG IgG, AGA IgA, AGA IgG, EMA IgA, EMA IgG), ... studied and lack of adequate controls Finally, no studies have been performed, in CD patients of a Central Region of Italy (Ancona, Marche, Italy) The aim of this case- control study was to assess...
- 6
- 305
- 0
Báo cáo y học: "Individual and occupational risk factors for knee osteoarthritis: results of a case-control study in Germany" pdf
... topics are available Our results not support the results of Sandmark and colleagues [25] and of Elsner and colleagues [28] Symptomatic knee OA and individual factors Symptomatic knee OA and body mass ... Instruments Standardised questionnaire The questionnaire was developed on the results of a literature review [12] Previous literature (in English and German) was analysed, and relevant risk factors and ... a standardised questionnaire, and a standardised patient record was filled out by an orthopaedic surgeon (cases only) In addition, participants with jobs involving lifting and carrying of loads...
- 15
- 322
- 0
Báo cáo y học: " Soluble receptor for advanced glycation end products in COPD: relationship with emphysema and chronic cor pulmonale: a case-control study" potx
... of RAGE lacking transmembrane and cytosolic domains, acts as a decoy receptor for RAGE ligands in the extracellular compartment, and is believed to afford protection against inflammation and ... Watanabe T, Asai K, Fujimoto H, Tanaka H, Kanazawa H, Hirata K: Increased levels of HMGB-1 and endogenous secretory RAGE in induced sputum from asthmatic patients Respir Med 2010 39 Wu L, Ma ... statistical analysis was performed with Stata version 10 (StataCorp, College Station, TX) Results Sample characteristics The baseline characteristics of the study sample are summarized in table The control...
- 9
- 417
- 0
Báo cáo y học: " Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study" pptx
... Statistical analysis SPSS 12.0 software package (Chicago, IL) was used for statistical analyses, and p < 0.05 was considered statistically significant Normal distribution was evaluated by Shapiro-Wilkinson's ... capillary flow and thus a decrease in Vc This will result in a reduction in surface area available for gas exchange, and therefore in a decrease of Dm [25] Secondly, parenchymal and vascular destruction ... pulmonary and cardiovascular function Hemodynamic data resulting from right heart catheterisation are shown in table No significant correlations between TLCO%, Dm%, Vc% and mPpa, PVR, SvO2 and PAH-...
- 8
- 264
- 0
Báo cáo y học: " Soy consumption and risk of COPD and respiratory symptoms: a case-control study in Japan" ppsx
... the data and drafted the manuscript AHL and YZ analysed the data and revised the manuscript CWB designed the study and revised the manuscript TH, YT and KN assisted with data collection and interpretation ... participants by gender and case- control status The average age of subjects was about 66 years For the prevalent case group, 220 patients (80%) had their COPD diagnosed within the past two years The ... cancer and cardiovascular disease [22] Its validity and reproducibility had been established for the Japanese population [23] The reference recall period for dietary variables was set at years before...
- 7
- 341
- 0
Báo cáo y học: "Association between occupation and knee and hip replacement due to osteoarthritis: a case-control study" doc
... data analysis and drafting the manuscript JF, TI and SL conceived the study TI, ME and SL revised the manuscript All authors participated in data analysis and all authors approved the final version ... questionnaire, leaving 490 men and 592 women as our controls The cases and controls were thus of similar age and from the same genetic pool Cases and controls signed an informed consent and answered a ... occupation and knee and hip OA leading to arthroplasty in Icelandic men and women This case- control study compares 1,408 individuals with knee and or hip arthroplasty due to OA with their relatives...
- 9
- 297
- 0
Báo cáo y học: "Early tracheostomy in intensive care trauma patients improves resource utilization: a cohort study and literature review" pdf
... error of the mean, and were compared using t-tests Medians and interquartile ranges are also given Categorical variables are expressed as absolute and relative frequencies, and were compared using ... ↓pneumonia if tracheostomy was performed earlier than days [2 ]a Prospective randomized multicentre 157 eligible patients Head-trauma, Nonhead trauma, no trauma First randomization: 3–5 days Second randomization: ... Percutaneous tracheostomy (n [%]) Values are expressed as mean ± standard error of the mean, where appropriate APACHE, Acute Physiology and Chornic Health Evaluation; GCS, Glasgow Coma Scale;...
- 6
- 325
- 0
Báo cáo y học: "Interleukin-4 (IL4) and Interleukin-4 receptor (IL4RA) polymorphisms in asthma: a case control study" ppt
... notatum, A fumigatus, dog, cat, hamster, horse and rabbit dander and cockroach (ALK-Abelló, Madrid, Spain) Saline was used as negative control and histamine 10 mg/ml was used as positive control Antihistamines ... 96:365-371 Shirakawa I, Deichmann KA, Izuhara I, Mao I, Adra CN, Hopkin JM: Atopy and asthma: genetic variants of IL-4 and IL-13 signalling Immunol Today 2000, 21:60-64 Sandford AJ, Chagani T, Zhu ... and 576Q>RIL4RA SNPs Phenotype -33C>T IL4 Controls Asthma Allergic Asthma Non-allergic Asthma Intermittent Asthma Persistent Asthma 576Q>R IL4RA Controls Asthma Allergic Asthma Non Allergic Asthma...
- 7
- 449
- 0
Báo cáo y học: "Polymorphisms of two histamine-metabolizing enzymes genes and childhood allergic asthma: a case control study" doc
... 10:261-266 17 Sasaki Y, Ihara K, Ahmed S, Yamawaki K, Kusuhara K, Nakayama H, Nishima S, Hara T: Lack of association between atopic asthma and polymorphisms of the histamine H1 receptor, histamine H2 ... herbarum; pollen: grass mix, rye, birch pollen, alder, hazel – Allergopharma, Germany) Any reaction with mean wheal diameter at least mm greater than negative control was regarded positive and ... 16:40-42 19 Garcia-Martin E, Garcia-Menaya J, Sanchez B, Martinez C, Rosendo R, Agundez JA: Polymorphisms of histamine-metabolizing enzymes and clinical manifestations of asthma and allergic rhinitis...
- 6
- 241
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008