a cardiovascular risk factor and a target for treatment
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
Ngày tải lên :
06/03/2014, 22:21
... Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid-resistant mutants of elongation factor ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... conformation (C), and EF-G stability (D) Several mutations seem to affect more than one of these parameters; for example, EF-G conformation and stability are intimately linked to FA binding as...
- 15
- 474
- 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
Ngày tải lên :
16/03/2014, 18:20
... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable ... 20 amino acids of mAK-L (MAAADEPKPKKLKVEAPQA) are replaced by four residues (MTST) in mAK-S This results in a length of 361 and 345 amino acids for mAK-L and mAK-S, respectively Mouse and human...
- 9
- 497
- 0
Báo cáo y học: "Cardiovascular risk factors and acute-phase response in idiopathic ascending aortitis: a case control study" pptx
Ngày tải lên :
09/08/2014, 13:22
... status and cardiovascular risk factors was examined by means of logistic regression models Each cardiovascular risk factor was examined individually and after adjustment for gender Analyses are ... G, Nakazawa T, Morinobu A, Kumagai S: Impact of smoking as a risk factor for developing rheumatoid arthritis: a meta-analysis of observational studies Ann Rheum Dis 2009 in press Sakalihasan N, ... elastases, cysteine proteases, and lipoxygenases that are important for extracellular matrix degradation and aneurysm formation [31,32] Exposure of endothelial cells to cigarette smoke increases...
- 6
- 366
- 0
báo cáo khoa học: "An overview of cardiovascular risk factor burden in sub-Saharan African countries: a socio-cultural perspective" ppsx
Ngày tải lên :
11/08/2014, 14:21
... Senegal, Seychelles, Sierra Leone Somalia, South Africa, Sudan, Swaziland, Tanzania, Togo, Uganda, Zambia, Zimbabwe Disease /Risk Factor Specific Cardiovascular disease/heart disease/heart failure, ... Gabon, Gambia, Ghana, Guinea, Guinea-Bissau, Kenya, Lesotho, Liberia, Madagascar, Malawi, Mali, Mauritania, Mauritius, Mozambique, Namibia, Niger, Nigeria, Reunion, Rwanda, Sao Tome and Principe, ... http://www.globalizationandhealth.com/content/5/1/10 Table 1: Geographical and risk factor related key words Region/Country Specific Africa, sub-Saharan Africa, additionally each country in sub-Saharan Africa was also searched by name: Angola,...
- 12
- 516
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
Ngày tải lên :
06/03/2014, 09:22
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr...
- 10
- 434
- 0
Báo cáo khoa học: Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra docx
Ngày tải lên :
08/03/2014, 10:20
... LVTAEEAGNKPL TAN, and fragment 3, NADIWER, the following sense and antisense primers were designed: GAG /A GAG /A GCG/T/ C GGG/T/C AAT/C AAG /A CC for fragment and AAT/C GCG/T/C ATA/T/C TGG GAG CG for ... dynamics of apical and basal regeneration in Hydra vulgaris (formerly Hydra attenuata) Dev Biol 144, 78– 85 42 Leontovich, A. A., Zhang, J., Shimokawa, K., Nagase, H & Sarras, M.P Jr (2000) A novel ... elevated in comparison to the mature adult foot region (Figs 10F and 9A) In buds, which are close to maturity and departure from the parental animal, the timing of the appearance and the localization...
- 10
- 389
- 1
Báo cáo khoa học: "Electro-acupuncture and Chinese herbs for treatment of cervical intervertebral disk disease in a dog" potx
Ngày tải lên :
07/08/2014, 20:23
... Y ealagyloP xidaR sisnenis acilegnA xidaR ataraperP eazihrrycylG xidaR eaidnalkcuA xidaR gnesniG xidaR easonipS ihpiziZ nemeS nagnoL sullirA irasydeH ues ilagartsA xidaR etipsoH ongiL muc airoP ... ealleiruobedeL xidaR imomanniC xetroC sbreH airoP eallihporcaM eanaitneG xidaR irasA xidaR eatatnediB sihtnaryhcA xidaR eaimmocuE xetroC ihtnaroL sulumaR sitnecsebuP eacilegnA xidaR leahcimraC itinocA rebuT ... muc airoP ealahpecorcaM sidiolytcartA amozihR gnaT iP iuG 79 eainnamheR xidaR ablA ainnoeaP xidaR sisneniS acilegnA xidaR eazihrrycylG xidaR gnesniG xidaR gnuoixnauhC icitsugiL amozihR ealleiruobedeL...
- 4
- 330
- 0
Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"
Ngày tải lên :
25/10/2012, 10:51
... body fat was substantial, and in most cases larger than the corresponding loss in lean mass According to our data, the average percentage loss of lean mass was 5.7±4.7 and the average change in ... be a major underlying mechanism for the heightened cardiovascular burden that occurs with increased adiposity The goal of our study was to examine how cardiovascular risk factors and circulating ... coronary atherosclerosis, congestive heart failure, arrhythmias, and stroke [5-11] In addition to established cardiovascular risk factors, systemic inflammation, increased oxidative stress, and altered...
- 8
- 594
- 0
Social factors as a basis for treatment
Ngày tải lên :
01/11/2013, 09:20
... therefore, which clubhouse elements are effective and which standards are necessary for success 175 Social factors as a basis for treatment Conclusion Social factors can affect the course and ... International Congress on Treatments in Psychiatry: An Update, Florence, Italy.) Gegenava, M and Kavtaradze, G (2006) Risk factors for coronary heart disease in patients with schizophrenia Georgian ... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors as a basis for treatment Integration of vocational rehabilitation and mental health services Supported...
- 16
- 524
- 0
Báo cáo y học: "Postictal psychosis: presymptomatic risk factors and the need for further investigation of genetics and pharmacotherapy" doc
Ngày tải lên :
08/08/2014, 21:20
... corticothalamic and thalamocortical connections of macaque prefrontal cortex J Comp Neurol 1987, 257(2):269-281 Monji A, Yanagimoto K, Maekawa T, Sumida Y, Yamazaki K, Kojima K: Plasma folate and ... Oxcarbazepine was administered at a dose of 600 mg twice daily, as was valproic acid at a dose of 500 mg three times daily and 750 mg at night Lorazepam was administered at mg three times daily ... prolactin levels were elevated to 20.4 ng/mL at hours after presentation Ammonia, vitamin B12, serum folate, and thryroid measures were normal, and RPR was non-reactive ESR, ANA, and rheumatoid factor...
- 6
- 514
- 0
Báo cáo y học: "Biomarkers of endothelial dysfunction, cardiovascular risk factors and atherosclerosis in rheumatoid arthritis" pptx
Ngày tải lên :
09/08/2014, 06:22
... and 7.7% for ICAM-1, and 5.4% and 6.0% for ELAM-1 Statistical analysis The traditional and nontraditional risk factors were compared using the Mann–Whitney U-test (continuous variables) and the ... control Available online http://arthritis-research.com/content/7/3/R634 Table Cardiovascular risk factors in RA patients and control individuals Risk factors Controls Patients P Traditional risk factors ... Table Spearman correlations among biomarkers and potential cardiovascular risk factors Cardiovascular risk factor VCAM-1 (pg/ml) ICAM-1 (pg/ml) ELAM-1 (pg/ml) 0.279 0.149 0.148 Smoking (cigarettes/day)...
- 10
- 422
- 0
Báo cáo y học: "Expression of ADAM15 in rheumatoid synovium: up-regulation by vascular endothelial growth factor and possible implications for angiogenesis" ppt
Ngày tải lên :
09/08/2014, 07:20
... 5'-TCCGCAGAAAGCAGCCATAGGGGGTAGGCT-3' Forward 5'-AGAGCTGACCCAGATCCCATGAAGAACACG-3' Reverse 5'-GCGTTCTTGAAAACACTCCTGGGCCTTACT-3' Forward 5'-AAAATAGCACACCAGATGGAGTTGCAATTG-3' Reverse 5'-ATTCCCACAGTACTTCAGTCTAAATATATT-3' ... 5'-TCCAAAGTTATGTCCAACTTCGTGAGCAAAAGTAA-3' Forward 5'-GAGACCCTCAAGGCAACTAAGTATGTGGAG-3' Reverse 5'-CGGCAGGTTAAACAGGCACACCCCCATTCC-3' Forward 5'-CTGGGACAGCGCCACATTCGCCGGAGGCGG-3' Reverse 5'-TCCGCAGAAAGCAGCCATAGGGGGTAGGCT-3' ... 5'-AGGGGCGTTGGCGAGGCACACCGACTGCGG-3' Forward 5'-GCTGTCTTGCCACAGACCCGGTATGTGGAG-3' Reverse 5'-TGGAATATTAAGAAGGCAGTTTCCTCCTTT-3' Forward 5'-ATCCAGTCATGTTAAAGCGATTGATACAATTTAC-3' Reverse 5'-TCCAAAGTTATGTCCAACTTCGTGAGCAAAAGTAA-3'...
- 16
- 402
- 0
báo cáo khoa học:" Dentin dysplasia type I: a challenge for treatment with dental implants" ppt
Ngày tải lên :
12/08/2014, 00:20
... extraction postoperative panoramic radiographs after tooth extraction and bone augmentation Figure and bone augmentation postoperative panoramic radiographs after implant setting postoperative panoramic ... iliac alveolar (below) using autogenousmaxilla (above) and the alveolar ridge augmentation of the maxilla (above) and the mandible (below) using autogenous bone grafts from the iliac crest Page ... the lacking bone, a bilateral sinus lifting procedure and a simultaneous alveolar ridge augmentation of the maxilla and the mandible using autogenous corticocancellous block and particulate bone...
- 5
- 279
- 0
Báo cáo y học: "The economic burden of inpatient paediatric care in Kenya: household and provider costs for treatment of pneumonia, malaria and meningitis" ppsx
Ngày tải lên :
13/08/2014, 11:22
... pneumonia and malaria cases To obtain the average total cost of treatment per case we added up the cost of drugs, diagnostic investigations and hospital stay costs Average treatment costs at the national ... Okoko J, Oluwalana C, Vaughan A, Obaro S, Leach A, et al.: Efficacy of nine-valent pneumococcal conjugate vaccine against pneumonia and invasive pneumococcal disease in The Gambia: randomised, ... capacity For malaria, a disease with a standard and widely available diagnostic approach, the cost of investigation and drug treatment in Page 11 of 13 (page number not for citation purposes) Cost...
- 13
- 343
- 0
Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk pot
Ngày tải lên :
09/08/2014, 10:20
... Chicago, IL, USA) Data was analyzed using the Kruskal-Wallis one-way analysis of variance on ranks Pairwise multiple comparison was made with the Holm-Sidak method Foam cell formation and staining ... Adams K, Adams JM: Indomethacin therapy for patent ductus arteriosus in premature infants: efficacy of a dosing strategy based on a seconddose peak plasma indomethacin level and estimated plasma ... leukemia virus) reverse transcriptase primed with oligo dT cDNA was amplified with specific primers (48 pmol/reaction) for ABCA1 (forward primer 5'-GAAGTACATCAGAACATGGGC-3' and reverse primer 5'GATCAAAGCCATGGCTGTAG-3'...
- 11
- 223
- 0
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx
Ngày tải lên :
12/08/2014, 20:20
... measurements were available than for others, and this may have influenced our results However, glucose measurements were taken randomly with each arterial blood gas analysis, and because mean ... prognosis, primarily in patients with obstructive vascular disease such as those with acute myocardial infarction and acute stroke, and in those who have undergone cardiovascular bypass surgery and peripheral ... cohort of patients undergoing resection for adenocarcinoma of the oesophagus (i.e patients with a low prevalence of risk factors for insulin resistance and cardiovascular disease but who are subject...
- 6
- 368
- 0
Báo cáo y học: "Analysis and evaluation of environmental tobacco smoke exposure as a risk factor for chronic cough" docx
Ngày tải lên :
13/08/2014, 08:20
... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... men For women, significant values were found for heavy ETS exposure in small spaces and in large indoor areas and for total ETS exposure [60] Figure search for the terms cough and tobacco and ... between ETS for respiratory diseases such as adult and pediatric asthma Also a series of epidemiological analyses on parental smoking and respiratory health in children have been performed [60,64,65,4,66-71]...
- 6
- 304
- 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
Ngày tải lên :
13/08/2014, 13:22
... intermittent asthma, each with mild persistent and moderate persistent asthma, and with severe persistent asthma No patient had Page of (page number not for citation purposes) Clinical and Molecular Allergy ... infiltrates or arterial hypoxemia The study excluded children with an exacerbation of reactive airways disease If patients with sickle cell disease are at increased risk of airway inflammation and ... Additionally, spirometry was not routinely performed during ED and hospital admissions Although other EDs and hospitals in the metropolitan area evaluate, treat, and admit pediatric patients with asthma...
- 5
- 288
- 0
Báo cáo y học: "A multicentre case-control study of nonsteroidal anti-inflammatory drugs as a risk factor for severe sepsis and septic shock" docx
Ngày tải lên :
13/08/2014, 16:20
... investigator All NSAIDs and aspirin were considered However, when aspirin was taken as an antiplatelet aggregant for the prevention of cardiovascular diseases (
- 7
- 467
- 0
Báo cáo y học: " Endothelial Bacteremia is an independent risk factor for mortality in nosocomial pneumonia: a prospective and observational multicenter study" potx
Ngày tải lên :
14/08/2014, 07:21
... tolerance and the variance inflation factor Variables associated with bacteremia in univariate analysis were included in a multivariate analysis for identification of independent variables after adjustment ... our data show A baumannii is an important pathogen isolated in respiratory samples of B-NP patients and is also an independent risk factor for bacteremia A baumannii has a high level of antibiotic ... resistance, but with a low virulence [25,26] A recent study that compared risk factors and outcomes for bacteremia due to A baumannii and Klebsiella pneumoniae showed bacteremia due to A baumannii...
- 8
- 311
- 0