a call for actio

Tài liệu India’s Undernourished Children: A Call for Reform and Action doc

Tài liệu India’s Undernourished Children: A Call for Reform and Action doc

... Orissa Nagaland Mizoram Meghalaya Manipur Maharashtra Madhya Pradesh Kerala Karnataka Jammu and Kashmir Haryana Gujarat Bihar Assam Andhra Pradesh % change Figure 10 Change in the prevalence of ... Meghalaya Manipur Maharashtra Kerala Madhya Pradesh Karnataka Jammu & Kashmir Haryana Urban prevalence 1998 Himachal Pradesh Goa Gujarat Bihar -80 Assam -60 Andhra Pradesh 10 Rural % change 92-98 ... Goa Mizoram Assam Manipur West Bengal Sikkim Jammu & Kashmir Tripura Meghalaya Kerala Orissa Tamil Nadu Arunachal Pradesh Delhi Maharashtra Andaman & NicobarIslands Haryana Pondicherry Lakshadweep...

Ngày tải lên: 12/02/2014, 12:20

116 504 0
Báo cáo y học: "The Council on Chiropractic Education''''s New Wellness Standard: A call to action for the chiropractic profession" ppt

Báo cáo y học: "The Council on Chiropractic Education''''s New Wellness Standard: A call to action for the chiropractic profession" ppt

... perform health education tasks appropriately and that their patients will be receptive to it from a DC rather than a primary care medical physician from whom many traditionally rely on for "health" ... that patient behavioral change is an easy task Additionally, we admit there are barriers to getting DC's to offer even relatively simple health education messages There are several potential barriers ... lbs up a flight of stairs Physical activity, if that of moderate intensity, should be performed in bouts of at least 10 minutes for a total of at least 30 minutes a day for at least days of the...

Ngày tải lên: 13/08/2014, 14:20

6 279 0
Tài liệu INDIGENOUS KNOWLEDGE FOR DEVELOPMENT: A FRAMEWORK FOR ACTION pptx

Tài liệu INDIGENOUS KNOWLEDGE FOR DEVELOPMENT: A FRAMEWORK FOR ACTION pptx

... process: Application: Transfer of the Washambaa agricultural system to Rwanda, adaptation, and re-transfer The Washambaa of the Usambara Mountains in Tanzania had developed a land use system emulating ... IK Application: Transfer of the Washambaa agricultural system to Rwanda adaptation and re-transfer The Washambaa of the Usambara Mountains in Tanzania had developed a land use system emulating ... participatory approaches are available for manual and computer use prepared by IIRR and CIKARD § case studies are available but could be packaged in a more user-friendly form § limited availability...

Ngày tải lên: 16/02/2014, 10:20

49 492 0
Women, Ageing and Health: A Framework for Action pot

Women, Ageing and Health: A Framework for Action pot

... expectancy among women are immense — for example, a baby girl born in France or Japan can expect to live more than 40 years longer than a baby girl born in sub-Saharan African countries There are also ... Indonesia 69 18 Sierra Leone 40 14 Russian Federation Sri Lanka 77 21 Switzerland 83 26 China 74 20 Bahrain 75 20 Japan 86 27 Pakistan 63 17 14 70 18 Papua New Guinea 61 Egypt AMRO Brazil Canada Haiti ... cataract surgery and eye care due to the cost of examinations, eye glasses, drops and surgery, as well as gender- and age-discrimination, and a lack of support for and information about treatment.20...

Ngày tải lên: 05/03/2014, 13:20

60 530 0
Global Health in Medical Education: A Call for More Training and Opportunities pptx

Global Health in Medical Education: A Call for More Training and Opportunities pptx

... A core curriculum for international health: evaluating 10 year’s experience at the University of Arizona Acad Med 1992;67:90–94 42 International Health Group Global Health Pathway Available at: ... Global Health comprehensive physical exam skills, and approach patients with greater cultural sensitivity—all attributes that make for becoming better clinicians International clinical rotations ... Several associations, organizations, and institutions have recently created scholarships and fellowships for medical students to pursue international research and training The Global Health Education...

Ngày tải lên: 14/03/2014, 21:20

5 640 0
Agriculture and Cancer: a need for action docx

Agriculture and Cancer: a need for action docx

... exposure disparities among seasonal farm workers and their families A serious cancer prevention agenda must ensure that policies and programs are in place to guarantee the safe and equitable working ... Starr County, Texas, Journal of Agricultural Safety and Health 2005; 11(1): 51–60 31 Arcury TA, Quandt SA, Austin CK, et al Implementation of EPA’s Worker Protection Standard Training for Agricultural ... that policies and programs are in place to guarantee the safe and equitable working conditions necessary to prevent cancer and other diseases in workers Both EPA and the Occupational Safety and...

Ngày tải lên: 15/03/2014, 01:20

12 381 0
Integrating Gender into the World Bank’s Work: A Strategy for Action potx

Integrating Gender into the World Bank’s Work: A Strategy for Action potx

... water are made each day at a round-trip distance of, conservatively, kms each, that makes a distance of 12.8 million km walked each day, day after day, by South African women, just to fetch water ... or social analyses to reach gender-related policy and programmatic recommendations; or • preparing a free-standing report based on existing analytical materials and/or new analyses or data To lower ... may be a stand-alone document or part of the poverty assessment or other larger analytical products (for example, a country social or economic analysis) The CGA may contain original analytical...

Ngày tải lên: 22/03/2014, 21:20

92 360 0
Preventing Child Maltreatment and Promoting Well-Being: A Network for Action doc

Preventing Child Maltreatment and Promoting Well-Being: A Network for Action doc

... se valen las familias cuando la vida se pone difícil Basarse en estas fortalezas es una forma comprobada de mantener a la familia fuerte y prevenir el abuso y abandono de menores Esta hoja de ... edad escolar Lo que está pasando Los niños edades entre y 12 a os atraviesan por grandes cambios A medida que pasan más tiempo en la escuela y fuera de casa, ellos trabajan para desarrollar una ... para ayudar a los padres La organización Childhelp® brinda una línea nacional de apoyo las 24 horas del d a (1.800.4 .A. CHILD) para padres que necesitan ayuda o consejos de crianza Recuerde: Manténgase...

Ngày tải lên: 23/03/2014, 06:20

70 262 0
NatioNal Drug Strategy 2010–2015: A framework for action on alcohol, tobacco and other drugs pdf

NatioNal Drug Strategy 2010–2015: A framework for action on alcohol, tobacco and other drugs pdf

... Other drugs and substances that are legally available can cause serious harm The harmful use of inhalants, like petrol, paint and glue, can cause brain damage and death The misuse of pharmaceutical drugs can have serious ... Disadvantage and social isolation Drug use can have a significant impact on disadvantaged groups and lead to intergenerational patterns of disadvantage • There is strong evidence of an association ... data, and Australian Bureau of Statistics and Australian Institute of Health and Welfare reports National surveys such as the National Survey of Community Satisfaction with Policing, as well as...

Ngày tải lên: 29/03/2014, 20:20

32 489 0
from the plan, generates alerts to call for action, promotes proactive recommendations for alert docx

from the plan, generates alerts to call for action, promotes proactive recommendations for alert docx

... consolidation technologies extract, clean, and aggregate the information from a variety of operational systems A data warehouse is a scalable platform for collecting this vast amount of information and ... inconsistencies and inaccurate results IBM BPM solutions are based on DB2 relational databases, as well as a combination of DB2 relational databases and DB2 OLAP databases In most cases, the BPM ... Meets BI Workplace™ capabilities for business performance management visualization and collaboration Business services management for consolidated and dynamic resource management for aligning IT...

Ngày tải lên: 21/06/2014, 12:20

23 272 0
Báo cáo y học: "Neurology Case Reporting: a call for all" doc

Báo cáo y học: "Neurology Case Reporting: a call for all" doc

... American Medical Association: Graduate medical education directory 19971998 Chicago: The Association; 1997, 25-31 Petrusa ER, Weiss GB: Writing case reports: an educationally valuable experience for ... Rison RA: Branch Facial Nerve Trauma Following Superficial Temporal Artery Biopsy: a case report Journal of Medical Case Reports 13 Kidd M, Hubbard C: Introducing Journal of Medical Case Reports ... happened, removed the pains now mentioned, or made them easier ” [7] A good story stays with you for life Case reports are an essential complement to textbook reading and are an ideal venue for...

Ngày tải lên: 11/08/2014, 00:23

2 244 0
Báo cáo y học: "Weakness in the ICU: a call to action" potx

Báo cáo y học: "Weakness in the ICU: a call to action" potx

... [14] Gerovasili and colleagues applied EMS daily to bilateral quadriceps and peroneus longus muscles during a 7-day period, and muscle mass was estimated ultrasonographically by quadriceps crosssectional ... is associated with limb weakness and delayed weaning in critical illness Crit Care Med 2007, 35:2007-2015 Herridge MS, Cheung AM, Tansey CM, Matte-Martyn A, DiazGranados N, Al-Saidi F, Cooper AB, ... RW, Shintani AK, Thompson JL, Gordon SM, Hall JB, Dittus RS, Bernard GR, Ely EW: Efficacy and safety of a paired sedation and ventilator weaning protocol for mechanically ventilated patients in...

Ngày tải lên: 13/08/2014, 19:20

2 258 0
bhide - a call for judgment; sensible finance for a dynamic economy (2010)

bhide - a call for judgment; sensible finance for a dynamic economy (2010)

... influence of a small group of individuals who often shared the same worldview was also remarkable Cassano and his traders, for instance, may have facilitated a trillion dollars of mortgages and triggered ... characterization of the liberal view, “are rendered unnecessary by competitive markets that make force or fraud unavailing.”6 Even informal social associations can more harm than good by facilitating ... or via the Internet—plays at least as important a role in coordinating actions and aggregating information Extensive dialogue with suppliers is particularly crucial for innovators who integrate...

Ngày tải lên: 01/11/2014, 18:05

366 184 0
Tài liệu Continued Concentration in Audit Market for Large Public Companies Does Not Call for Immediate Action docx

Tài liệu Continued Concentration in Audit Market for Large Public Companies Does Not Call for Immediate Action docx

... AICPA AMEX CAQ CEO CFO CPA DOJ EDGAR EITF FASB FTC GAAP GAAS GLS HHI IOSCO IPO NAICS NASBA NYSE OLS OTCBB PAR PCAOB SEC American Institute of Certified Public Accountants American Stock Exchange ... obtain capital from their partners To conduct an audit of a public company, an Page GAO-08-163 Public Companies accounting firm establishes an engagement team that is typically headed by a lead ... the same audit firm for many years, there were almost 6,000 changes in auditors between 2003 and 2007 We analyzed data from Audit Analytics and found that 102 large companies had changed auditors...

Ngày tải lên: 18/02/2014, 05:20

120 301 0
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

... proteins extracted from plasma membranes and membrane pellets were then analyzed by SDS/PAGE and autoradiography Figure shows that after incubation with labelled MSSAE, membranes contained radioactive ... FEBS 2003 Disuldes and antitumor action of BS-RNase (Eur J Biochem 270) 1981 acid) and alkaline phosphatase-conjugated anti-rabbit secondary Ig were purchased from Sigma Reagents for Western blotting ... Fig Autoradiography of SDS/PAGE runs of the labelled monomeric derivative of BS-RNase 125I-labelled MSSAE incubated with plasma membranes (PM) from SVT2 cells Lane 1, plasma membranes treated for...

Ngày tải lên: 20/02/2014, 11:20

8 605 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Collaboration and Action to Improve Child Health Systems: A Toolkit for State Leaders docx

Collaboration and Action to Improve Child Health Systems: A Toolkit for State Leaders docx

... basis Primary Care Case Management Primary care case management (PCCM) is a form of managed care that can be used to create and sustain a medical home model Participat­ ing families choose a ... org/tabid/631/Default.aspx (Accessed March 19, 2009.) Raphael JL, Guadagnolo BA, Beal AC, and Giardino AP Racial and ethnic disparities in indicators of a primary care medical home for children Acad Pediatr ... Medicaid managed care arrangements depend on contracts appropriate to child health needs and systems Medicaid Managed Care and Child Managed Care Arrangements and Contracts Health To a great extent,...

Ngày tải lên: 14/03/2014, 09:20

52 417 0
A Manual for Integrating Gender Into Reproductive Health and HIV Programs: FROM COMMITMENT TO ACTION pptx

A Manual for Integrating Gender Into Reproductive Health and HIV Programs: FROM COMMITMENT TO ACTION pptx

... sex-disaggregated micro- and macro-economic data and national statistics on social development Information about labor force participation and segmentation, incomes, poverty rates, educational attainment, ... strategic advantage Intended Audience The primary audience for this Manual is in-country RH and HIV/AIDS program managers and technical staff of USAID cooperating agencies (CAs), governmental organizations ... a philosophy that allows participants to understand and examine local practices in a non-judgmental way; to receive new, especially technical, information in a way that they can understand; and...

Ngày tải lên: 14/03/2014, 15:20

71 608 0
Food and health in Europe: a new basis for action pdf

Food and health in Europe: a new basis for action pdf

... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... information and data so that they can make informed decisions to prevent harm Nationally collected data can be compared with international norms and standards to ensure that public health is at...

Ngày tải lên: 16/03/2014, 14:20

38 334 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

... data suggest that PAR3 does not mediate signal transduction directly but instead acts as a cofactor for the cleavage and activation of PAR4 [27] Thrombin has been shown to cleave and activate PAR1, ... to date are PAR1, PAR2, PAR3 and PAR4; each has a similar mechanism of action has a distinct sequence at its cleavage site As a consequence, synthetic peptides have been developed that mimic ... 3-kinase) Ig was obtained from TCS Biologicals (Botolph Claydon, UK) and [c-32P]ATP from Amersham (Amersham) PAR activating peptides, Ser-Phe-Leu-LeuArg-Asn for PAR1 and Gly-Tyr-Pro-Gly-Lys-Phe for...

Ngày tải lên: 24/03/2014, 03:21

10 437 0
w