a c gene expression of osteogenic markers p lt 0 05

... structure Examples of ceramics based materials include calcium phosphates, calcium sulfates and bioactive glass These materials, particularly the calcium phosphates, have been widely used as scaffolds ... e.g PLGA The advantages and possible drawbacks of each material will be described 20 2.3.3.1 Bioceramics Bioceramics are inorganic and non-metallic materials that can assume a crystalline structure ... has a higher surface area Its porosity ranges from 50 to 90% and is highly vascular, often containing bone marrow [2] Microscopically, compact and cancellous bones are different in that compact...

Ngày tải lên: 09/09/2015, 17:52

... 400 0 3 500 p( watt) 300 0 2 500 200 0 1 500 100 0 500 0 10 15 Wind speed (m\s) 20 25 30 Figure Blade length effect of mechanical power 1 200 0 100 00 P( watt) 800 0 600 0 400 0 200 0 0 0.5 1.5 Wind speed (m\s) ... 100 0 900 800 700 p( watt) 600 500 400 300 200 Air pressure= 800 00 Pa Air pressure= 100 000 Pa Air pressure=1 100 00 Pa 100 0 10 15 Wind speed (m\s) 20 25 30 Figure Air pressure effect of wind power of ... pressure= 800 00 Pa Air pressure= 100 000 Pa Air pressure=1 100 00 Pa 500 0 10 15 Wind speed (m\s) 20 25 30 Figure Air pressure effect of wind power for Whisper- 500 wind generator ( 0C= 25) ISSN 207 6-2895 (Print),...

Ngày tải lên: 05/09/2013, 16:10

... Technologies), cDNA was produced with the RNA PCR Core kit from Perkin Elmer (Roche) and primers 11 (5¢-CTAGCTAGCATGACAGA GTTACCTGCACC-3¢) and 12 (5¢-ATAGTTTAGCG GCCGCTAGATATAAAATTGATGGAATGC-3¢) were ... pGAL4-VP16 [26] (a gift from G E O Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer (5¢-GCTCTAGAGCTTCAC ... with primer (5¢-GGACCAGACCCCACGCAACG-3¢) and primer 10 (5¢-GCCCTGCTTCATCCCCGTGG-3¢) and cloned into the pSP72/5GAL-E1bEGFP construct at the NdeI site The presenilin constructs, pIRESpuro2/PS1...

Ngày tải lên: 08/03/2014, 08:20

... PH (1991) Cellular Calcium: a Practical Approach The Practical Approach Series Oxford University Press, New York, NY CPP activity and supramolecular structure 60 Cantu L, Corti M, Lago P & Musolino ... compilation ª 200 7 FEBS 500 1 CPP activity and supramolecular structure C Gravaghi et al KRH (containing phosphate) phosphate-free KRH A B 100 [Ca2+]o 2mmol/L 100 [Ca2+]o 4mmol/L peak calcium increase (% ... compilation ª 200 7 FEBS 500 5 CPP activity and supramolecular structure C Gravaghi et al of the biologically active aggregates, the simultaneous presence of CPP and Ca2+ is needed while complexes are...

Ngày tải lên: 16/03/2014, 05:20

... mica Clı´ nica, Facultad de Ciencias Quı´ mica, UNC, Argentina) The authors also thank G Schachner and S Deza for technical assistance with the cell culture and C Mas for excellent assistance ... with confocal microscopy and image analysis A. R.Z and P. M .C are recipients of CONICET (Argentina) Fellowships J.L.D and N .P. K are Career Investigators of CONICET (Argentina) References Hakomori, ... (Molecular Probes) and fluorescein-conjugated rat anti-IgG2b (Pharmingen) at a dilution of : 800 or : 700 , respectively, for 90 at 37 C Appropriate controls were included to guarantee the specificity...

Ngày tải lên: 16/03/2014, 16:20

... revealed that periodic arrays of GeMn nanodots can be formed on Ge and GaAs substrates at low temperature (approximately 70 C) due to the matched lattice constants of Ge (5.656 Å) and GaAs (5.653 ... concentration Appl Phys Lett 200 7, 90: 052 508 11 Wang Y, Xiu FX, Zou J, Wang KL, Jacob AP: Tadpole shaped Ge0.96Mn0 .04 magnetic semiconductors grown on Si Appl Phys Lett 201 0, 96:3 12 Ayoub JP, Favre L, ... Ronda A, Morresi L, Pinto N: Morphological and structural evolutions of diluted Ge1-xMnx epitaxial films Appl Phys Lett 200 7, 91:1419 20 13 Ottaviano L, Passacantando M, Picozzi S, Continenza A, ...

Ngày tải lên: 18/06/2014, 22:20

... 200 7 87. 50 65 .00 87. 50 90. 00 70. 00 57. 50 137. 50 97. 50 47. 50 95 .00 80. 00 200 8 65 .00 62. 50 57. 50 85 .00 60. 00 50. 00 100 .00 85 .00 30. 00 63.75 67. 50 200 9 42. 50 57. 50 45 .00 67. 50 45 .00 40. 00 75 .00 ... area of 0. 015 appeared to be successful Košulič ( 201 0) regarded 0. 01 shelterwood gaps as optimal for the regeneration of oak According to Lüpke ( 200 8), small-area close-to-nature management weakens ... regeneration growth parameters with light conditions N_ 200 7 N_ 200 8 N_ 200 9 N_ 201 0 Mortality d.r .c increment hi sum Canopy openness (%) 0. 19 0. 02 -0. 02 -0. 08 0. 36 0. 55 0. 60 TSF (%) 0. 18 0. 09 0. 10...

Ngày tải lên: 07/08/2014, 10:21

... adicicsip d hP adicicsip d hP adicicsip d hP atarua surapS la te adicicsip d hP la te ,adicicsip d hP la te adicicsip d hP noissucsiD adicicsip psbus ealesmad muiretcabotohP fo yticinegitnA .477-177 ... noitazinummi-tsop skeew ta esnopser ydobitna ni esaercni tnacifingis a dewohs hsiF )CEWA( tnavujda ni )SPCc( edirahccasylop raluspac edurc dna )PCE( stcudorp ralullecartxe gniniatnoc snoitaraperp llec elohw ... cificeps edirahccasylopopil adicicsip alleruetsaP fo yassA R adusuK ,S arahiM ,A arabustaM 32 8992 -09 92 ,06 ,4991 loiborciM norivnE lppA hsif rof yticinegohtap ni elor sti dna adicicsip alleruetsaP...

Ngày tải lên: 07/08/2014, 23:22

... Diurnal gas exchange, chlorophyll fluorescence, shoot water potential and hydraulic conductance determinations Dark respiration rates, Amax and leaf water status at a saturating irradiance ( 200 ... Photosynthetic performance of Sitka spruce 417 Figure Variation in maximum photosynthetic rate (Amax), stomatal conductance (Gs) and the ratio of internal to ambient CO2 concentration (Ci/Ca) ... Images of projected shoot area were captured using a flat bed scanner and their area determined using Scion Imaging Software (Beta 4 .0. 1, Scion Corporation, Maryland, USA) Photosynthetic performance...

Ngày tải lên: 08/08/2014, 00:22

... For each analysis of variance, Tukey’s test was used to compare the means Analysis of variance was performed separately for each sky condition and time period A four-way analysis of variance (methods, ... RLRhc_corr), forest composition, elevation angle and azimuth angle Symbols are as follows: *** P < 0. 000 1, ** P < 0. 01, * P < 0. 05, NS = P > 0. 05 Forest Stands Source Aspen, Jack Pine, and Spruce ... (Populus tremuloides Michx.), Jack pine (Pinus banksiana Lamb.) and spruce (Picea glauca (Moench) Voss and Picea mariana (Mill.) BSP) in Quebec, and stands of red alder (Alnus rubra Bong.) and...

Ngày tải lên: 08/08/2014, 00:22

... 700 - 60 600 500 - 80 Soil water deficit (mm) Wood density (kg m-3) 100 0 400 - 100 300 year (1996/97) 200 Aug Oct Dec Feb Apr year (1997/98) Jun Aug Oct Dec Feb Apr -1 20 Jun Aug 1 200 20 (b) 1 100 ... density - 20 900 800 - 40 700 - 60 600 500 - 80 SWD Soil water deficit (mm) Wood density (kg m-3) 100 0 400 - 100 300 year (1996/97) 200 Aug Oct Dec Feb Apr year (1997/98) Jun Aug Oct Dec Feb Apr -1 20 Jun ... at 1 20 kg ha–1 elemental P Nitrogen was applied as urea at 100 kg ha–1 elemental N in three applications ( 40% in August, 30% in both December and March) in 19 90/ 91 and 1991/92 and at 60 kg ha–1...

Ngày tải lên: 08/08/2014, 14:20

... floor accumulation and litter decomposition in a radiata pine plantation, For Ecol Manag 70 (1994) 299–3 10 [8] Díaz-Ravi a M., Acea M.J., Carballas T., Seasonal changes in microbial biomass and ... 31.8 cm Analysis of needles revealed a deficiency of P and low concentrations of N and Mg According to the FAO system of climate classification, the area can be described as Temperate Subtropic ... year-old) Pinus radiata D Don plantation located 10 km east of Lugo (NW Spain) at an altitude of 500 m above sea-level The understorey vegetation consisted of Rubus spp., Adenocarpus complicatus...

Ngày tải lên: 08/08/2014, 14:21

... to changes in physiological characteristics such as light compensation point, are probably important when competition takes place in hybrid poplar stands because fast-growing species are usually ... Heckrodt W.F., Close spaced short rotation poplar production using paper mill sludge as mulch, in: Barkley B .A. , McVey G (Eds.), Poplar Culture to the Year 200 0, Proceedings of the Poplar Councils ... Varian, Spectra AA- 300 / 400 operation manual, Varian, Mulgrave, Australia, 1988 [ 50] Wang J.R., Simard S.W., Kimmins J .P. , Physiological responses of paper birch to thinning in British Columbia,...

Ngày tải lên: 08/08/2014, 14:21

... [23] Gallego H .A. , Santa Regina I Rico M., Rapp M., Variación estacional de la concentración de nutrientes en hojas y ramas en bosques naturales de Quercus pyrenaica Willd (Sierra de Gata, Españ ;a) , ... description and stand characteristics study area The co-ordinates of the and 6° 43’ W Spain) area is classified as warm FG The dominant soils are humic Cambisols developed schist and greywackes at NF and ... nutrients, according to Carceller et al [8]; this assumption is difficult to accept if severe defoliation has occurred (e.g EP) As a result, the inclusion of damaged leaves in the calculation would lead...

Ngày tải lên: 08/08/2014, 14:21

... type 0. 055 Needle density ratio (gr cm ) 1991 0. 035 0. 0 30 0 .02 5 0. 0 20 0 .01 5 0. 30 0.25 0. 20 0.15 0. 10 0 .01 0 0. 05 0. 005 0. 00 0 .00 0 19 90 1991 19 90 19 90 1991 Wide Acute Branch angle type 0. 5 m Spacing ... 0. 60 0. 50 0. 40 0. 30 0. 20 0. 50 0. 10 0 .00 0. 00 19 90 1991 19 90 19 90 1991 Wide Acute Branch angle type 1991 0. 45 0. 0 50 0. 40 0 .04 5 0. 35 0. 0 40 Leaf weight ratio -2 19 90 Wide Acute Branch angle type 0. 055 ...

Ngày tải lên: 08/08/2014, 14:22

... natural death of the apical bud during the winter, and of experimental decapitation of the shoot apex on Q petraea, have clearly shown that loss of the apical bud increases lateral branch production ... who described oak as having strong apical dominance and weak apical control The ter- minology of apical dominance versus apical control has proved to be useful to describe general patterns of tree ... and activity in vegetative buds of trees Ann Sci For 46 (Suppl), 9s-26s Champagnat P, Payan E, Champagnat M, Barnola P, Lavarenne S, Bertholon C (1986) La croissance rythmique de jeunes chênes p donculés...

Ngày tải lên: 08/08/2014, 18:21

... the pattern of y solute but exaggerated any rise of potential, due to the fall in P bark ofl:en associated with rises in osmotic potential of the expressed sap The relative conductivity decreased ... the present studies, it decreased with time irrespective of treatment (Table I) This decrease may be attributable to the export of starch to developing roots and leaves Starch acts source Although ... initially and then increased gradually This decrease may be due to decreased water absorption by the cuttings until the functional roots were formed Grange and Loach (1983) opined that the decrease...

Ngày tải lên: 09/08/2014, 04:20

... 10 10 3 0 1 19 27 4 10 12 38 21 30 15 24 0 1 0 0 1 0 1 0 0 0 0 2 0 0 0 0 1 0 0 0 2 0 0 0 4 3 0 0 1 0 1 0 0 5 0 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0 0 0 2 1 1 0 0 0 3 0 0 0 1 0 0 0 0 0 0 2 1 0 ... treatments ABI3VP1 Alfin-like AP2-EREBP ARF ARID ARR-B AUX/IAA BBR/BPC BES1 bHLH BSD bZIP C2 C2-CO-like C2 C2-Dof C2 C2-GATA C2 C2-YABBY C2 H2 C3 H CAMTA CCAAT Coactivator p1 5 CPP DBP TF Family Up 12 ... Up 10 25 10 24 20 10 17 16 2 0. 5 down 12 65 17 48 25 28 13 Up 0 0 0 1 0 0 0 0 Up 2 0 2 0 10vs13IR 0. 2 down 0 0 2 0 2 0 Number of genes 0. 5 down 0 0 2 3 0 Up 0 0 0 1 0 0 0 0.2 down 0 0 1 0 0 0...

Ngày tải lên: 11/08/2014, 11:21

... 0. 99 0. 97 0. 97 0. 01 12 0. 8 0. 89 0. 85 0. 95 0. 89 0. 81 0. 93 0. 89 0. 04 Average 0. 90 0.93 0. 92 0. 95 0. 93 0. 88 0. 98 0. 95 0. 93 0. 02 SD 0. 06 0. 04 0. 04 0. 03 0. 04 0. 07 0. 02 0. 03 0. 04 0. 01 type of repeating ... 0. 87 0. 02 0. 82 0. 94 0. 94 0. 92 0. 94 0. 91 0. 97 0. 96 0. 95 0. 02 0. 9 0. 95 0. 95 0. 96 0. 95 0. 94 0. 98 0. 96 0. 95 0. 02 10 0.92 0. 87 0. 92 0. 97 0. 87 0. 85 0. 98 0. 89 0. 91 0. 05 11 0. 9 0. 96 0. 97 0. 98 0. 96 0. 95 0. 99 ... specificity (SPEC) and positive predictive value (PPV) were calculated as: SENS = TP/(TP+FN); SPEC = TN/(TN+FP); and PPV = TP/ (TP+FP) To facilitate comparison to accuracy calculations by Matos...

Ngày tải lên: 13/08/2014, 10:20