a c gene expression of osteogenic markers p lt 0 05
Effects of combined mechanical and pulsed electromagnetic field stimulations on the osteogenesis of bone marrow stem cells
... structure Examples of ceramics based materials include calcium phosphates, calcium sulfates and bioactive glass These materials, particularly the calcium phosphates, have been widely used as scaffolds ... e.g PLGA The advantages and possible drawbacks of each material will be described 20 2.3.3.1 Bioceramics Bioceramics are inorganic and non-metallic materials that can assume a crystalline structure ... has a higher surface area Its porosity ranges from 50 to 90% and is highly vascular, often containing bone marrow [2] Microscopically, compact and cancellous bones are different in that compact...
- 209
- 1,817
- 0
Performance analysis of wind turbine systems under different parameters effect
... 400 0 3 500 p( watt) 300 0 2 500 200 0 1 500 100 0 500 0 10 15 Wind speed (m\s) 20 25 30 Figure Blade length effect of mechanical power 1 200 0 100 00 P( watt) 800 0 600 0 400 0 200 0 0 0.5 1.5 Wind speed (m\s) ... 100 0 900 800 700 p( watt) 600 500 400 300 200 Air pressure= 800 00 Pa Air pressure= 100 000 Pa Air pressure=1 100 00 Pa 100 0 10 15 Wind speed (m\s) 20 25 30 Figure Air pressure effect of wind power of ... pressure= 800 00 Pa Air pressure= 100 000 Pa Air pressure=1 100 00 Pa 500 0 10 15 Wind speed (m\s) 20 25 30 Figure Air pressure effect of wind power for Whisper- 500 wind generator ( 0C= 25) ISSN 207 6-2895 (Print),...
- 10
- 545
- 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc
... Technologies), cDNA was produced with the RNA PCR Core kit from Perkin Elmer (Roche) and primers 11 (5¢-CTAGCTAGCATGACAGA GTTACCTGCACC-3¢) and 12 (5¢-ATAGTTTAGCG GCCGCTAGATATAAAATTGATGGAATGC-3¢) were ... pGAL4-VP16 [26] (a gift from G E O Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer (5¢-GCTCTAGAGCTTCAC ... with primer (5¢-GGACCAGACCCCACGCAACG-3¢) and primer 10 (5¢-GCCCTGCTTCATCCCCGTGG-3¢) and cloned into the pSP72/5GAL-E1bEGFP construct at the NdeI site The presenilin constructs, pIRESpuro2/PS1...
- 12
- 471
- 0
Báo cáo khoa học: Casein phosphopeptide promotion of calcium uptake in HT-29 cells ) relationship between biological activity and supramolecular structure ppt
... PH (1991) Cellular Calcium: a Practical Approach The Practical Approach Series Oxford University Press, New York, NY CPP activity and supramolecular structure 60 Cantu L, Corti M, Lago P & Musolino ... compilation ª 200 7 FEBS 500 1 CPP activity and supramolecular structure C Gravaghi et al KRH (containing phosphate) phosphate-free KRH A B 100 [Ca2+]o 2mmol/L 100 [Ca2+]o 4mmol/L peak calcium increase (% ... compilation ª 200 7 FEBS 500 5 CPP activity and supramolecular structure C Gravaghi et al of the biologically active aggregates, the simultaneous presence of CPP and Ca2+ is needed while complexes are...
- 13
- 468
- 0
Báo cáo khoa học: Membrane distribution of epidermal growth factor receptors in cells expressing different gangliosides doc
... mica Clı´ nica, Facultad de Ciencias Quı´ mica, UNC, Argentina) The authors also thank G Schachner and S Deza for technical assistance with the cell culture and C Mas for excellent assistance ... with confocal microscopy and image analysis A. R.Z and P. M .C are recipients of CONICET (Argentina) Fellowships J.L.D and N .P. K are Career Investigators of CONICET (Argentina) References Hakomori, ... (Molecular Probes) and fluorescein-conjugated rat anti-IgG2b (Pharmingen) at a dilution of : 800 or : 700 , respectively, for 90 at 37 C Appropriate controls were included to guarantee the specificity...
- 10
- 327
- 0
Báo cáo sinh học: "Structural evolution of GeMn/Ge superlattices grown by molecular beam epitaxy under different growth " pot
... revealed that periodic arrays of GeMn nanodots can be formed on Ge and GaAs substrates at low temperature (approximately 70 C) due to the matched lattice constants of Ge (5.656 Å) and GaAs (5.653 ... concentration Appl Phys Lett 200 7, 90: 052 508 11 Wang Y, Xiu FX, Zou J, Wang KL, Jacob AP: Tadpole shaped Ge0.96Mn0 .04 magnetic semiconductors grown on Si Appl Phys Lett 201 0, 96:3 12 Ayoub JP, Favre L, ... Ronda A, Morresi L, Pinto N: Morphological and structural evolutions of diluted Ge1-xMnx epitaxial films Appl Phys Lett 200 7, 91:1419 20 13 Ottaviano L, Passacantando M, Picozzi S, Continenza A, ...
- 11
- 318
- 0
Báo cáo lâm nghiệp: "Natural regeneration of sessile oak under different light conditions" pptx
... 200 7 87. 50 65 .00 87. 50 90. 00 70. 00 57. 50 137. 50 97. 50 47. 50 95 .00 80. 00 200 8 65 .00 62. 50 57. 50 85 .00 60. 00 50. 00 100 .00 85 .00 30. 00 63.75 67. 50 200 9 42. 50 57. 50 45 .00 67. 50 45 .00 40. 00 75 .00 ... area of 0. 015 appeared to be successful Košulič ( 201 0) regarded 0. 01 shelterwood gaps as optimal for the regeneration of oak According to Lüpke ( 200 8), small-area close-to-nature management weakens ... regeneration growth parameters with light conditions N_ 200 7 N_ 200 8 N_ 200 9 N_ 201 0 Mortality d.r .c increment hi sum Canopy openness (%) 0. 19 0. 02 -0. 02 -0. 08 0. 36 0. 55 0. 60 TSF (%) 0. 18 0. 09 0. 10...
- 10
- 327
- 0
Báo cáo khoa học: " Variation in the molecular weight of Photobacterium damselae subsp. piscicida antigens when cultured under different conditions in vitro" pot
... adicicsip d hP adicicsip d hP adicicsip d hP atarua surapS la te adicicsip d hP la te ,adicicsip d hP la te adicicsip d hP noissucsiD adicicsip psbus ealesmad muiretcabotohP fo yticinegitnA .477-177 ... noitazinummi-tsop skeew ta esnopser ydobitna ni esaercni tnacifingis a dewohs hsiF )CEWA( tnavujda ni )SPCc( edirahccasylop raluspac edurc dna )PCE( stcudorp ralullecartxe gniniatnoc snoitaraperp llec elohw ... cificeps edirahccasylopopil adicicsip alleruetsaP fo yassA R adusuK ,S arahiM ,A arabustaM 32 8992 -09 92 ,06 ,4991 loiborciM norivnE lppA hsif rof yticinegohtap ni elor sti dna adicicsip alleruetsaP...
- 7
- 334
- 0
Báo cáo lâm nghiệp: "Interactive effects of irradiance and water availability on the photosynthetic performance of Picea sitchensis seedlings: implications for seedling establishment under different management practices" ppt
... Diurnal gas exchange, chlorophyll fluorescence, shoot water potential and hydraulic conductance determinations Dark respiration rates, Amax and leaf water status at a saturating irradiance ( 200 ... Photosynthetic performance of Sitka spruce 417 Figure Variation in maximum photosynthetic rate (Amax), stomatal conductance (Gs) and the ratio of internal to ambient CO2 concentration (Ci/Ca) ... Images of projected shoot area were captured using a flat bed scanner and their area determined using Scion Imaging Software (Beta 4 .0. 1, Scion Corporation, Maryland, USA) Photosynthetic performance...
- 10
- 345
- 0
Báo cáo lâm nghiệp: "The angular distribution of diffuse photosynthetically active radiation under different sky conditions in the open and within deciduous and conifer forest stands of Quebec and British Columbia, Canada" pptx
... For each analysis of variance, Tukey’s test was used to compare the means Analysis of variance was performed separately for each sky condition and time period A four-way analysis of variance (methods, ... RLRhc_corr), forest composition, elevation angle and azimuth angle Symbols are as follows: *** P < 0. 000 1, ** P < 0. 01, * P < 0. 05, NS = P > 0. 05 Forest Stands Source Aspen, Jack Pine, and Spruce ... (Populus tremuloides Michx.), Jack pine (Pinus banksiana Lamb.) and spruce (Picea glauca (Moench) Voss and Picea mariana (Mill.) BSP) in Quebec, and stands of red alder (Alnus rubra Bong.) and...
- 11
- 256
- 0
Báo cáo khao học: "High-resolution analysis of radial growth and wood density in Eucalyptus nitens, grown under different irrigation regimes" potx
... 700 - 60 600 500 - 80 Soil water deficit (mm) Wood density (kg m-3) 100 0 400 - 100 300 year (1996/97) 200 Aug Oct Dec Feb Apr year (1997/98) Jun Aug Oct Dec Feb Apr -1 20 Jun Aug 1 200 20 (b) 1 100 ... density - 20 900 800 - 40 700 - 60 600 500 - 80 SWD Soil water deficit (mm) Wood density (kg m-3) 100 0 400 - 100 300 year (1996/97) 200 Aug Oct Dec Feb Apr year (1997/98) Jun Aug Oct Dec Feb Apr -1 20 Jun ... at 1 20 kg ha–1 elemental P Nitrogen was applied as urea at 100 kg ha–1 elemental N in three applications ( 40% in August, 30% in both December and March) in 19 90/ 91 and 1991/92 and at 60 kg ha–1...
- 6
- 341
- 0
Báo cáo khoa học: "Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques" pps
... floor accumulation and litter decomposition in a radiata pine plantation, For Ecol Manag 70 (1994) 299–3 10 [8] Díaz-Ravi a M., Acea M.J., Carballas T., Seasonal changes in microbial biomass and ... 31.8 cm Analysis of needles revealed a deficiency of P and low concentrations of N and Mg According to the FAO system of climate classification, the area can be described as Temperate Subtropic ... year-old) Pinus radiata D Don plantation located 10 km east of Lugo (NW Spain) at an altitude of 500 m above sea-level The understorey vegetation consisted of Rubus spp., Adenocarpus complicatus...
- 12
- 312
- 0
Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps
... to changes in physiological characteristics such as light compensation point, are probably important when competition takes place in hybrid poplar stands because fast-growing species are usually ... Heckrodt W.F., Close spaced short rotation poplar production using paper mill sludge as mulch, in: Barkley B .A. , McVey G (Eds.), Poplar Culture to the Year 200 0, Proceedings of the Poplar Councils ... Varian, Spectra AA- 300 / 400 operation manual, Varian, Mulgrave, Australia, 1988 [ 50] Wang J.R., Simard S.W., Kimmins J .P. , Physiological responses of paper birch to thinning in British Columbia,...
- 13
- 230
- 0
Báo cáo khoa học: "Nutrient efficiency and resorption in Quercus pyrenaica oak coppices under different rainfall regimes of the Sierra de Gata mountains (central western Spain)" pps
... [23] Gallego H .A. , Santa Regina I Rico M., Rapp M., Variación estacional de la concentración de nutrientes en hojas y ramas en bosques naturales de Quercus pyrenaica Willd (Sierra de Gata, Españ ;a) , ... description and stand characteristics study area The co-ordinates of the and 6° 43’ W Spain) area is classified as warm FG The dominant soils are humic Cambisols developed schist and greywackes at NF and ... nutrients, according to Carceller et al [8]; this assumption is difficult to accept if severe defoliation has occurred (e.g EP) As a result, the inclusion of damaged leaves in the calculation would lead...
- 11
- 361
- 0
Báo cáo khoa học: "Performance of young jack pine trees originating from two different branch angle traits under different intensities of competition" ppt
... type 0. 055 Needle density ratio (gr cm ) 1991 0. 035 0. 0 30 0 .02 5 0. 0 20 0 .01 5 0. 30 0.25 0. 20 0.15 0. 10 0 .01 0 0. 05 0. 005 0. 00 0 .00 0 19 90 1991 19 90 19 90 1991 Wide Acute Branch angle type 0. 5 m Spacing ... 0. 60 0. 50 0. 40 0. 30 0. 20 0. 50 0. 10 0 .00 0. 00 19 90 1991 19 90 19 90 1991 Wide Acute Branch angle type 1991 0. 45 0. 0 50 0. 40 0 .04 5 0. 35 0. 0 40 Leaf weight ratio -2 19 90 Wide Acute Branch angle type 0. 055 ...
- 15
- 234
- 0
Báo cáo khoa học: "Height growth, shoot elongation and branch development of young Quercus petraea grown under different levels of resource availability" pptx
... natural death of the apical bud during the winter, and of experimental decapitation of the shoot apex on Q petraea, have clearly shown that loss of the apical bud increases lateral branch production ... who described oak as having strong apical dominance and weak apical control The ter- minology of apical dominance versus apical control has proved to be useful to describe general patterns of tree ... and activity in vegetative buds of trees Ann Sci For 46 (Suppl), 9s-26s Champagnat P, Payan E, Champagnat M, Barnola P, Lavarenne S, Bertholon C (1986) La croissance rythmique de jeunes chênes p donculés...
- 17
- 240
- 0
Báo cáo lâm nghiệp: "of stem cuttings of Populus x euramericana under different water potentials" ppt
... the pattern of y solute but exaggerated any rise of potential, due to the fall in P bark ofl:en associated with rises in osmotic potential of the expressed sap The relative conductivity decreased ... the present studies, it decreased with time irrespective of treatment (Table I) This decrease may be attributable to the export of starch to developing roots and leaves Starch acts source Although ... initially and then increased gradually This decrease may be due to decreased water absorption by the cuttings until the functional roots were formed Grange and Loach (1983) opined that the decrease...
- 3
- 198
- 0
báo cáo khoa học: "Comparative analysis of root transcriptome profiles of two pairs of drought-tolerant and susceptible rice near-isogenic lines under different drought stress" doc
... 10 10 3 0 1 19 27 4 10 12 38 21 30 15 24 0 1 0 0 1 0 1 0 0 0 0 2 0 0 0 0 1 0 0 0 2 0 0 0 4 3 0 0 1 0 1 0 0 5 0 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0 0 0 2 1 1 0 0 0 3 0 0 0 1 0 0 0 0 0 0 2 1 0 ... treatments ABI3VP1 Alfin-like AP2-EREBP ARF ARID ARR-B AUX/IAA BBR/BPC BES1 bHLH BSD bZIP C2 C2-CO-like C2 C2-Dof C2 C2-GATA C2 C2-YABBY C2 H2 C3 H CAMTA CCAAT Coactivator p1 5 CPP DBP TF Family Up 12 ... Up 10 25 10 24 20 10 17 16 2 0. 5 down 12 65 17 48 25 28 13 Up 0 0 0 1 0 0 0 0 Up 2 0 2 0 10vs13IR 0. 2 down 0 0 2 0 2 0 Number of genes 0. 5 down 0 0 2 3 0 Up 0 0 0 1 0 0 0 0.2 down 0 0 1 0 0 0...
- 50
- 370
- 0
Báo cáo y học: " Validation of an ambulatory cough detection and counting application using voluntary cough under different conditions" potx
... 0. 99 0. 97 0. 97 0. 01 12 0. 8 0. 89 0. 85 0. 95 0. 89 0. 81 0. 93 0. 89 0. 04 Average 0. 90 0.93 0. 92 0. 95 0. 93 0. 88 0. 98 0. 95 0. 93 0. 02 SD 0. 06 0. 04 0. 04 0. 03 0. 04 0. 07 0. 02 0. 03 0. 04 0. 01 type of repeating ... 0. 87 0. 02 0. 82 0. 94 0. 94 0. 92 0. 94 0. 91 0. 97 0. 96 0. 95 0. 02 0. 9 0. 95 0. 95 0. 96 0. 95 0. 94 0. 98 0. 96 0. 95 0. 02 10 0.92 0. 87 0. 92 0. 97 0. 87 0. 85 0. 98 0. 89 0. 91 0. 05 11 0. 9 0. 96 0. 97 0. 98 0. 96 0. 95 0. 99 ... specificity (SPEC) and positive predictive value (PPV) were calculated as: SENS = TP/(TP+FN); SPEC = TN/(TN+FP); and PPV = TP/ (TP+FP) To facilitate comparison to accuracy calculations by Matos...
- 8
- 303
- 0
- p lt 0 001 p lt 0 01 p lt 0 05
- nhất ở nhóm nmvr thấp nhất ở nhóm utg sự khác biệt có ý nghĩa thống kê p lt 0 05 bảng 3 6
- tỷ lệ mọc vi khuẩn của phương pháp cấy mảnh sinh thiết đại tràng 16 20 trường hợp cao hơn rất nhiều so với phương pháp cấy phân 2 20 trường hợp sự khác biệt này có ý nghĩa thống kê với p lt 0 05
- so sánh tương quan hai biến định tính bằng kiểm định or tỷ xuất chênh odds ratio or có ý nghĩa khi p lt 0 05 và khoảng 95 ci không chứa 1
- dùng hệ số tương quan pearson r để tìm mối tương quan giữa các biến định lượng tương quan có ý nghĩa khi p lt 0 05 r gt 0 tương quan thuận r lt 0 tương quan nghịch
- giá trị p lt 0 05 được coi là có ý nghĩa thống kê
- tỷ lệ đqnmn ở nam 10 9 nhiều hơn ở nữ 1 8 với p lt 0 05
- nhận xét sự khác biệt không có ý nghĩa thống kê p lt 0 05
- nhận xét thời gian nằm viện trung bình là 9 73±5 20 ngày không có sự khác biệt có ý nghĩa thồng kê giữa các mức độ mắc u tế bào sao ác tính khác nhau p lt 0 05
- sự khác biệt về nhu cầu điều trị ở 2 giới là có ý nghĩa thống kê với p lt 0 05
- bình thường có ý nghĩa thống kê với p lt 0 05
- ất phải cabệnh nhân với p lt 0 05
- nhóm u gt 50mm cho thời gian mổ và lượng máu mất nhiều hơn hẳn nhóm u ≤ 50mm với p lt 0 05
- gt 0 05 p lt 0 05
- tỷ lệ tử vong 13 3 trong đó tỷ lệ tử vong cao ở nhóm sdd 15 3 ở nhóm shh spo2 lt 80 cao gấp 4 46 lần so với nhóm có spo2 gt 80 p lt 0 05
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25