a c and av switch
iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to
Ngày tải lên :
25/12/2013, 10:57
... C 466 are met 3.102.3 Cubicle switchgear and controlgear Metal-enclosed switchgear and controlgear, other than switchgear and controlgear COPYRIGHT 2002; International Electrotechnical Commission ... controlgear (with - cubicle switchgear and controlgear one or more non-metal1ic.partition.s); 3.102.1 Metal-clad switchgear and controlgear Metal-enclosed switchgear and controlgear inwhich components ... insulating material 3.102.2 Compartmented switchgear and controlgear (with non-metallic partitions) Metal-enclosed switchgear and controlgear in which components are arranged in separate compartments...
- 139
- 465
- 0
Tài liệu tiếng anh Điện tử công suất mạch MERS A new AC current switch called MERS with low on state voltage IGBTs for renewable energy and power saving applications
Ngày tải lên :
15/10/2013, 16:10
... synchronous reactance can be cancelled and the output power increased A requirement for such a compensator is that it shall be able to operate during variable speed and not cause any resonant ... Wiik, T Takaku, F D Wijaya, T Kitahara, and R Shimada, “Improvement of synchronous generator characteristics using bi-directional current phase control switch, ” EPE-PEMC, 2006 B Andresen and J Birk, ... control the phase of the current [5] D Device characteristics To facilitate the success of the MERS application, it is important to consider the special characteristics seen from a semiconductor...
- 8
- 888
- 1
Tài liệu Debugging C and C++ code in a Unix environment ppt
Ngày tải lên :
21/01/2014, 06:20
... static analysis early; see the section called Using the compiler’s features Explicit storage allocation and deallocation In C and C+ +, you have to explicitly allocate and deallocate dynamic storage ... Show matching braces • Automatic indentation • Easy navigation (like vi’s and emacs’ tags) • Easy compiling (e.g vim’s :make or emacs’ compile) 18 Chapter Aspects of debugging C and C+ + code A version ... the causes of problems with C and C+ + code, is the policy of requiring explicit allocation and deallocation of dynamic storage (malloc(2) and free(2) (C) or new and delete (C+ +)) As C and C+ +...
- 29
- 466
- 1
A study on code switching techniques used in translating english terms and vietnamese equivalents in electronics
Ngày tải lên :
29/01/2014, 10:33
... utterances According to Michael (1989), translation tactics with CS techniques are applied in the second language acquisition in learning and teaching process as a way to insert phonological translation ... be accessible and acceptable by other classmates Last but not least, CS techniques applied in English classes for electronics at COTECH are inter-sentential, intra-sentential, and intra- word CS ... professional and amateur translators, and language teachers, but also to electronic engineers and mathematicians” In the long history of translation, concepts of translation have been mentioned by a...
- 38
- 631
- 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
Ngày tải lên :
08/03/2014, 08:20
... Psesa Psest Psesp Bacst Actsp Bac11 Bac17 Bac38 Bac663 Bac1011 BacA2 Bac1018 BacE1 BacKC Bacbr Bacci8 Bacci251 BacciA Baccl Bacli BacmaIB7 BacIFO Bacoh Bacst1 Bacst2 Klepn Nossp Thbsp Thbth Thcsp ... Reference withdrawn Takada, M., Nakagawa, Y & Yamamoto, M (2003) Biochemical and genetic analyses of a novel c- cyclodextrin glucanotransferase from an alkalophilic Bacillus clarkii 7364 J Biochem ... pneumoniae CGT Nostoc sp PCC 9229 CGT Thermococcus sp B1001 CGT Actinoplanes sp SE50 ACT Bacillus stearothermophilus MAA Aspergillus kawachii AAM Bacillus sp TS-23 AAM Streptomyces griseus AAM Pseudomonas...
- 11
- 615
- 0
C++?? A Critique of C++ and Programming and Language pot
Ngày tải lên :
08/03/2014, 23:20
... expand inline, and avoid the function call overhead So in this case, friend is a superfluous mechanism In Java, classes in the same package can access instance variables from other classes in a ... concern the programmer are visible in C+ + A better choice would have been a keyword such as ‘abstract’ Abstract should have syntactic significance as abstract functions are an important concept ... data in a class can also be divided into characteristic interface data which should be visible, and implementation 3rd Edition data which should be hidden Interface data are any characteristics...
- 63
- 511
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
Ngày tải lên :
17/03/2014, 03:20
... the localization of the b-aryl ether cleavage activity, we prepared a hyphae fraction (HP), an extracellular fraction (EC), a cytoplasmic fraction (CY) and a membrane fraction (M) from cultures ... enzymatic reaction was a hydrolytic reaction or an oxidative reaction, the enzymic activity Fig Localization of b-aryl ether cleavage function and assay for highmolecular mass lignin structure (A) ... indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU from GOU by cleaving...
- 10
- 670
- 0
Aaron r bradley programming for engineers a foundational approach to learning c and matlab
Ngày tải lên :
19/03/2014, 14:05
... elements (argc) and the actual array (argv) We introduce arrays and strings in Chapter and use them extensively in practice Saving this code in file sum .c and compiling it with the command gcc -Wall ... programs Rather than taking an abstract and rule-based perspective, this chapter covers the program stack and the function call protocol, which naturally give rise to these concepts A mechanistic ... plates in a cafeteria One can push data (plates) onto the stack and pop data (plates) off the stack In both cases, the operations a ect only the top of the stack Similarly, stack frames are pushed...
- 250
- 655
- 0
Nicolai josutis the c++ standard library a tutorial and reference
Ngày tải lên :
19/03/2014, 14:11
... Standard Library 3.4 Allocators The C+ + standard library uses in several places special objects to handle the allocation and deallocation of memory Such objects are called allocators An allocator represents ... polymorphic value For example: class Car; virtual function) // abstract base class (has at least one class Cabriolet : public Car { }; class Limousine : public Car { }; void f(Car* cp) { Cabriolet* ... Bjarne Stroustrup, and David Vandevoorde Special thanks to Dave Abrahams, Janet Cocker, Catherine Ohala, and Maureen Willard who reviewed and edited the whole book very carefully Their feedback...
- 642
- 408
- 1
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
Ngày tải lên :
23/03/2014, 06:20
... approximately 263 nm and a negative band at approximately 240 nm, whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 240 nm and ... of action Proc Natl Acad Sci USA 104, 17347–17352 15 DeCian A & Mergny JL (2007) Quadruplex ligands may act as molecular chaperones for tetramolecular quadruplex formation Nucleic Acids Res 35, ... with cisdiammine-diaquaplatinum at comparable rates J Inorg Biochem 101, 514–524 23 Chang CC, Chien CW, Lin YH, Kang CC & Chang TC (2007) Investigation of spectral conversion of d(TTAGGG)4 and...
- 9
- 324
- 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
Ngày tải lên :
23/03/2014, 13:20
... heart PKA The sense primer (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) overlapped ... fractionated between soluble and particulate fractions as described [21] Sarco/endoplasmic reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a ... Demaugre et al (Eur J Biochem 271) anti-HIP/PAP, anti-RIIa and anti-Ca (Transduction Laboratories, Lexington, KY, USA), anti-(SERCA 2) (clone IID8; Tebu, Paris, France) and anti-calreticulin (ABR...
- 9
- 310
- 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
Ngày tải lên :
24/03/2014, 03:21
... function as an AFP as well as its relationship to other CTLDs MATERIALS AND METHODS Materials N-Glycosidase F and endoproteinase Glu -C were obtained from Roche Molecular Biochemicals (Laval, Canada) ... the AFP has a separate undiscovered activity in smelt plasma, in which the N-linked oligosaccharide and dimeric character play more central roles Smelt AFP has been characterized in terms of Ca2+ ... the case This may be relevant to the calculation of smelt AFP activity The activity of smelt AFP is about one-third of that of sea raven AFP on a monomer concentration basis [11] As sea raven and...
- 8
- 518
- 0
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx
Ngày tải lên :
19/06/2014, 08:20
... The appeal of active participation may have influenced this perception The performance metrics indicate that the individual with SCI could control the switch with accuracies comparable to that ... LabView The threshold scaling factor was selectable in the 1.2-2.5 range, and was adjusted for each participant such that false activations due to blinks and movement were avoided and participants ... modification of parameters such as switch debounce time and activation thresholds, and provided the user with visual and auditory feedback when a muscle contraction was detected On detecting a contraction,...
- 10
- 501
- 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
Ngày tải lên :
20/06/2014, 01:20
... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA ... AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUAUCUUUUUCACAUUCUUAUUUACAUCGCUUGAUGC A GCCCUUUGUGAGGCUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACUUA AGCAGUAGCAAGAGGAUUUUUAGCAAGACCUA AGCAGUAGCAAGAGGAUUUUUAGUUUA ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA)...
- 11
- 427
- 0
Báo cáo hóa học: " Nanoscratch Characterization of GaN Epilayers on c- and a-Axis Sapphire Substrates" doc
Ngày tải lên :
21/06/2014, 08:20
... original author(s) and source are credited Table Critical lateral forces and values of l determined from nanoscratch trace depths within GaN films on c- and a- axis sapphire substrates Sample Normal ... tribological and chemical effects, rather than physical deformation and fracture, are believed to become dominant In this scenario, the average measured residual stress in the cracking zone is much ... deformed and strain-hardened lattice structure Conclusion We employed a combination of nanoindentation and AFM techniques to investigate the contact-induced deformation behavior of GaN films on c- and...
- 5
- 276
- 0
