a bug in firefox implementation of the navigation timing api
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
Ngày tải lên :
10/08/2014, 09:20
... the data analyses and interpretation, and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The author(s) declare that they have no competing ... expression of melanopsin in the photosensitive RGCs of the albino Wistar rat follow a circadian pattern Finally, these findings might provide additional insight into the reported changes in visual thresholds ... light, can be the result of changes in the circadian phototransduction mechanism in the retina, the circadian clock in the SCN, or both Changes in the relative values of these outcome measures...
- 9
- 363
- 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
Ngày tải lên :
21/06/2014, 05:20
... 2006 at both Binh Phuoc training centre and Dong Nai training centre The final training of the first year TOT training took place in May 2007 at both Dong Nai and Binh Phuoc training centres Trainees ... farmers who participated in this training Therefore, the course of training had already built up trainees’ confidence in using weaver ants as a major component of the cashew IPM program At the ... were the crematogaster ant, Crematogaster sp with large numbers occupying one third of the trees in the IPM plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining...
- 10
- 551
- 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
Ngày tải lên :
21/06/2014, 06:20
... TOT training, and they include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the ... TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the ... large numbers occupying one third of the trees in the IPM plot, and the small black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant...
- 12
- 531
- 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
Ngày tải lên :
21/06/2014, 06:20
... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 212 cashew farmers were interviewed, ... project Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by TOT trainees in their own provinces using a standard questionnaire ... expressed their interest in this program and were keen to participate in the FFS training Of the farmers that did not want to participate in the FFS training, one wanted to switch from cashew to...
- 7
- 400
- 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
Ngày tải lên :
21/06/2014, 06:20
... year TOT training as planned The final training of the first year TOT training took place in May 2007 at both Dong Nai and Binh Phuoc training centres This training occurred during the period of ... Number of trainees Binh Phuoc Dak Lak Dak Nong Binh Duong Dong Nai Binh Thuan Ba Ria Vung Tau Tay Ninh Tra Vinh Total 56 Table Training courses and course teachers in the final period of the first ... preparation, controlling of competitive species of ants, identification of weaver ant colonies, transplantation of the ants into cashew orchards, and management and maintenance of the weaver ant...
- 24
- 453
- 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
Ngày tải lên :
21/06/2014, 06:20
... separately compared by a non-parametric Friedman 2-way ANOVA by ranks using SYSTAT statistics software The percentage yield data and field survey data were analysed by a Kruskal-Wallis one-way ANOVA ... larvae cause the damage inside branches and the trunk, often resulting in the death of main branches or even the whole tree Our preliminary observations revealed that although weaver ants can ... base, and each larva excavated a chamber in which the calcareous pupal cell was formed from the excretions of the larva Pupation took place late in the year The pupa is about 35 mm long, creamy-white,...
- 26
- 491
- 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
Ngày tải lên :
21/06/2014, 06:20
... master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was held, and all the TOT trainees successfully passed their examinations ... successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 112 TOT cashew IPM trainers, and they are distributed in ten cashew growing ... methods and skills, and their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers...
- 10
- 302
- 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
Ngày tải lên :
21/06/2014, 06:20
... the training run by one or two TOT trainers and the field practice He talked with FFS farmers about the training topics and the training methods, and about what they had learned and what they ... demonstration orchards, pointing out the efficiency of using weaver ants to manage the main pest assemblage and the importance of keeping weaver ant populations high and stable • Part describes the ... FFS training on farmers’ knowledge and farming skills has been assessed against our baseline data Over 95% of farmers were happy with the FFS training contents, with the training methods, and with...
- 37
- 394
- 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
Ngày tải lên :
21/06/2014, 06:20
... training centre having 25 trainees; and Binh Phuoc training centre having 31 trainees The TOT training involves a pre-starting workshop, the first period of TOT training and establishment of ... since the project started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration ... activities, and he is also responsible for the implementation of the IPM program, for the part of the TOT training and for the field data analyses Dr Pham Van Bien and Mr La Pham Lan are in charge of...
- 10
- 327
- 1
báo cáo khoa học: " A matched-pair cluster design study protocol to evaluate implementation of the Canadian C-spine rule in hospital emergency departments: Phase III" ppt
Ngày tải lên :
11/08/2014, 05:22
... C-Spine Rule, and were categorized as indeterminate cases Seven of these 845 patients had clinically important CSI In the analysis that excluded the indeterminate cases, the Canadian C-Spine ... clinical application of the Canadian C-Spine Rule The ED and Radiology departments will collaborate to institute a process -of- care modification with a mandatory "online" reminder of the Canadian ... quickly and clinically clear the cervical spine of stable trauma patients without the need for complete radiography Rather than waiting hours in a resuscitation bay on a backboard, patients can be...
- 14
- 217
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
Ngày tải lên :
25/10/2012, 11:00
... management approaches, he was managed conservatively and was healthy on a follow-up Figure Neuroimaging of the twins (a) Cerebral CT of twin A shows a vast lesion of cerebrospinal fluid intensity in the ... head surgery17 In our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are ... NKCC1 was present in the AC wall These finding indicated NKCC1 gene might play an important role in cystogenesis The association of AC and other diseases in families suggested that PAPB2, SPG4 and...
- 4
- 652
- 0
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
Ngày tải lên :
13/04/2013, 10:30
... Philippines; Macro is in Thailand and Taiwan, Carrefour from France is in Taiwan; and Wellcome is in Taiwan, Hong Kong, Mainland China and Singapore Major Japanese department stores are in most Asian cities ... mushrooming all over the country’s main cities at an unprecedented growth rate And in Indonesia, the changing spending patterns within the Jakarta area are contributing to an increase in the use of department ... it already has 27 supermarkets in China and has an ambitious expansion plans of a chain of 1000 supermarkets operating across the country by the year 2005 Meanwhile, WalMart with its openings of...
- 51
- 1K
- 3
Radioactive waste in the Barents and Kara Seas - Russian implementation of the global dumping regime
Ngày tải lên :
01/11/2013, 09:20
... France and China Russian implementation of the global dumping regime 207 Having tried in vain to obtain a two-year delay, Russia filed, as the only contracting party, a formal reservation to the ... cooling, incineration or deactivation of radioactive installations – has been disposed of in the Barents Sea since the mid-1960s This past dumping is a matter of substantial concern in Russia and ... military handling of radioactive waste was becoming an international issue A former radiation safety engineer in the Murmansk Shipping Company, Andrey Zolotkov, who was also an activist in the...
- 21
- 486
- 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf
Ngày tải lên :
17/02/2014, 22:20
... and Biostatistical Activity (PASBA) also made a major contribution to the evaluation by generating the administrative data for the analysis of the effects of guideline implementation Their careful ... Administration Systems and Biostatistical Activity Primary care manager Pharmacoeconomic Center Patient-Level Cost Allocation Quality management Standard Ambulatory Data Record Standard Inpatient Data ... patients and management of the asthma to reduce the frequency of asthma exacerbations To the extent that MTFs strengthened these practices Implementation of the Asthma Practice Guideline in AMEDD Table...
- 212
- 442
- 0
Tài liệu Implementation of the Diabetes Practice Guideline in the Army Medical Department - Final Evaluation ppt
Ngày tải lên :
17/02/2014, 22:20
... and Biostatistical Activity (PASBA) also made a major contribution to the evaluation by generating the administrative data for the analysis of the effects of guideline implementation Their careful ... National Committee for Quality Assurance, American Academy of Family Physicians, American College of Physicians, DoD, and the VA 6 Implementation of the Diabetes Practice Guideline in AMEDD These ... utilization was an assessment of the adequacy of Army medical databases for monitoring the results of the guideline implementation as well as future follow-up and provider feedback The impact of the...
- 182
- 355
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
Ngày tải lên :
21/02/2014, 15:20
... 5¢-CAGGATCCATGACACTTCCTAGTGCG GCTCGC-3¢ and 5¢-CCAAGCTTTTATTGCTGATTAT TGGGATTCATTTGACCA-3¢ (the gene encoding the Drosophila CK2 a subunit does not contain introns in the coding region [21]) The ... was PCRamplified from the DNA of the cosmid clone #9 [18] using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase ... product was cloned as a fusion with the GAL4 activation domain in the pGAD424 vector, or as a fusion with the GAL4 DNAbinding domain in the pGBT9 vector (Clontech, La Jolla, CA, USA) To prepare CK2btes...
- 10
- 464
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
Ngày tải lên :
22/02/2014, 07:20
... Transformants were incubated h at 37 °C and overnight at room temperature in SOC medium and then plated on Luria–Bertani agar plates containing kanamycin Kanamycin resistant (KmR) transformants ... the amounts of UP12 and the total amount of protein in the extracts, a series of samples containing determined amounts of the purified UP12 were separated by SDS/PAGE along with the cell extract ... increases further during the late stationary phase As a result of this accumulation, the relative amount of UP12 in stationary cells is about 10 times higher than that observed at the beginning...
- 9
- 548
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... for the remainder of the protein is: large AAA subdomain, pink; small AAA subdomain, beige; b domain, orange; non-mutated region of C-terminal a helix, cyan (B) Close-up of part of the C-terminal ... are currently aimed at achieving a detailed understanding of the roles of the numerous components of the MVB sorting machinery Vps4 is an ATPase of the AAA (ATPase associated with a variety of...
- 23
- 490
- 0