... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head ... titanate particles appeared in the permanent cavity along the bullet path The cavity was covered with barium titanate particles along the entire bullet path Analysis of the temporary cavity To analyze ... [Characteristics of war wound infection] Acta Med Croatica 2006, 60:353-63 Zhang J, Yoganandan N, Pintar FA, Guan Y, Gennarelli TA: Experimental model for civilian ballistic brain injury biomechanics quantification...
Ngày tải lên: 11/08/2014, 20:21
... Quang HA XUAN., hereby submit my Dissertation for oral examination, entitled “Assessment of capability, knowledge and skill of vocational school graduates: A basis for enhanced industry-academe ... enterprises and vocational training schools has been an issue concerned by international and national researchers, learners and managers and also a heated topic in many international and national conferences ... skill of vocational school graduates: A basis for enhanced industry-academe cooperation” as thesis topic for DBA course As a vice rector of a professional university – Hanoi University of Industry,...
Ngày tải lên: 16/07/2014, 08:22
Assessment of capability, knowledge and skills of vocational school graduates a basis for enhanced industry academy cooperation
... 2.3.3 Factors affecting the quality of vocational training a External factors b The internal factors Quality of vocational training is the result of positive impacts of all elements in training ... knowledge and skill of vocational school graduates: A basis for enhanced industry-academe cooperation” as thesis topic for DBA course The research results will provide a basis for solutions for the ... Industry and Trade MOLISA NVQs QCA Ministry Of Labor, War Invalids and Social Affairs National Vocational Qualifications Qualifications and Curriculum Authority SLSU Southern Luzon State University...
Ngày tải lên: 09/05/2016, 16:41
Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx
... the assembly of the head of bacteriophage T4 Nature 227, 680–685 43 Ogawa, K., Tashima, M., Yumato, Y., Okuda, T., Sawada, H., Okuma, M & Maruyama, Y (1990) Coding sequence of human placenta cofilin ... filament turnover: pH sensitivity of F-actin by human ADF, but not of Acanthamoeba actophorin Biochemistry 256, 388–397 Iida, K., Moriyama, K., Matsumoto, S., Kawasaki, H., Nishida, E & Yahara, ... 3007.3007.12 Hatanaka, H., Ogura, K., Moriyama, M., Ichikawa, S., Yahara, I & Inagaki, F (1996) Tertiay structure of destrin and structural similarity between two actin-regulating protein families...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc
... the CHD and that of the DHD Correlation 4: translation and access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, ... Drosophila genome Data from Drosophila suggest that static domains form as the result of additional compartmentalization of chromatin that can function as insulators, which can have a further ... that tells the hardware how to implement computation and process information Information in the form of software abstraction also includes the organization of that information, as opposed to a...
Ngày tải lên: 13/08/2014, 16:20
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... comprehensive approach aimed at making the healthy choices available, affordable and attractive involves taking account of mainstreaming nutrition and physical activity into all relevant policies at local, ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence of obesity...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... is a collection of i.i.d mean A Poisson variables plus a finite number of particles which started at time zero at fixed locations (these are the particles added as B-particles at the start) For ... random-walk paths associated to the various particles and (1) (2) assume that the Markov processes {Yt } and {Yt } are constructed by means of the same set of paths A (·, ρ) starting with state ... right-hand side here for k ≥ The basic inequalities remain valid for k = by trivial modifications which we again leave to the reader For the various estimates we have to take all tk large This will automatically...
Ngày tải lên: 16/02/2014, 06:20
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere Distribution of bacteria As bacteria possess greater powers of resistance ... liquefying at surface; c, a rapid liquefying form; d, a gas-producing form that grows equally well in lower part of tube as at surface (facultative anaerobe); e, an obligate anaerobe, that develops ... cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable to such a...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management ... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic ... superior at achieving the manager's goals of obtaining appropriate-ate behavior from a variety of targets The first three propositions consider MOA separately Motivation is goal-directed arousal (Maclnnis,...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S ... Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic activity YN-1, K562, HeLa...
Ngày tải lên: 19/02/2014, 06:20
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers pot
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... United States of America National Academy of Sciences National Academy of Engineering Institute of Medicine National Research Council The National Academy of Sciences is a private, nonprofit, self-perpetuating ... Project Assistant SUZANNE OSSA, Senior Project Assistant DAVID DRAKE, Project Assistant DAVID PADGHAM, Research Assistant BRANDYE WILLIAMS, Office Assistant vi Preface C ontinued advances in information...
Ngày tải lên: 06/03/2014, 15:20
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating ... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: "Linguistically Motivated Features for Enhanced Back-of-the-Book Indexing" ppt
... number of instances of the minority class Aside from the fact that oversampling has hard to predict effects on classifier performance, it also has the additional drawback of increasing the size of ... Wikipedia articles and their link annotations can be treated as a vast keyword annotated corpus We make use of the Wikipedia annotations in two ways First, if a phrase is used as the title of a Wikipedia ... continues to grow with additional amounts of data, the steepest part of the curve is observed for up to 10% of the training data, which indicates that a relatively small amount of data (about 25 books)...
Ngày tải lên: 08/03/2014, 01:20
Identification of Research Needs Relating to Potential Biological or Adverse Health Effects of Wireless Communication pptx
... of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... GREENLEAF, Administrative and Financial Associate LAURA D LLANOS, Administrative and Financial Associate Courtney gibbs, Senior Program Assistant MANDI M BOYKIN, Senior Program Assistant SHAUNTEÉ ... University of Ottawa, Ontario, Canada Staff RICK JOSTES, Study Director NAOKO ISHIBE, Program Officer Toni Greenleaf, Financial and Administrative Associate Shaunteé Whetstone, Program Assistant JAMES...
Ngày tải lên: 15/03/2014, 15:20
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc
... constraints and creating a system that functions properly for the application domain while remaining understandable and manageable by human operators, users, and—in many cases—casual passersby, ... the relatively constrained capabilities of individual elements Adaptive coordination is a fairly new area of investigation, particularly as it applies to EmNets To obtain necessary adaptability ... from solar panels The limited amount of raw power available will have a substantial effect on all aspects of EmNets, from the amount of computation that can be performed on a local physical sensing...
Ngày tải lên: 15/03/2014, 15:20
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf
... composition analysis) or 24 s (for kinetic analysis), and separation was performed at 22 kV Peak integration was performed using 32 karat software (Beckman) Determination of kinetic parameters for GMD ... biochemical characterization of purified His6-tag fusions of GMD and RMD from P aeruginosa, and the structural characterization of RMD from A thermoaerophilus GDP-Rha NADPH GDP-Rha D NADPH NADP+ E NADPH ... and A thermoaerophilus were amplified from chromosomal DNA templates, using the following primer pairs: P aeruginosa, 5¢-AGGCCCGCTTC CGGATCCACTCAGCGTCTG-3¢ and 5¢-AAAAAAGTCG ACTTCTTCTCGTACCCGTGACTC-3¢;...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx
... plays a dual role – as a precursor of ADP for the first step and as an effector that causes conformational change of factors into low-affinity forms of enzymes to be reactivated The DhaF and DhaG ... identified as a reactivating factor for ethanolamine ammonia-lyase, although the details of its mechanism of action have not yet been reported [43] Recently, MeaB, a bacterial homolog of MMAA or CblA ... B12-dependent dehydratases and reactivating factors H Kajiura et al 40 Shibata N, Mori K, Hieda N, Higuchi Y, Yamanishi M & Toraya T (2005) Release of a damaged cofactor from a coenzyme B12-dependent...
Ngày tải lên: 16/03/2014, 05:20
Food and health in Europe: a new basis for action pdf
... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic of Moldova ... Greece Malta Italy Spain Portugal Israel France Switzerland Netherlands Germany United Kingdom Austria Belgium Sweden Denmark Norway Finland Yugoslavia Bulgaria Hungary Romania Slovakia Czech...
Ngày tải lên: 16/03/2014, 14:20
The Help! Kit - A Resource Guide for Secondary Teachers of Migrant English Language Learners
... federal and state legislative initiatives and various national, state, and local organizations, all of which involve the effort to make English the official language of the U.S The initiatives and ... in a classroom that is usually comprised of half native English speakers and half native speakers of the other language (Christian, D., 1994) CALP—Cognitive academic language proficiency; a mastery ... Home-School Partnerships,” for more in-depth information.) The family is essentially patriarchal, at least to outward appearances The roles of males and females are clearly defined—males are seen as the...
Ngày tải lên: 17/03/2014, 17:46