... Representatives are often families of Rosaceae, Lauraceae, Apocynaceae, Theaceae, Magnoniaceae, Juglandaceae, Fagaceae, Aceraceae, etc (6) Xuan Son National Park has high differentiation on vegetation ... BIGNONIACEAE Markhamia cauda-felina (Hance) Craib Fernandoa brilletii (P.Dop) Steenis BURSERACEAE Canarium tonkinensis L CAESALPINIACEAE Senna siamea Lam DIPTEROCARPACEAE Hopea chinensis (Merr.) Hand.-Mazz ... rice-leaf weeds such as Thysanolaena maxima, Saccharum arundicaceum, Miscanthus nepalensis, Miscanthus japonica, Miscanthus japonica, Saccharum spontaneum, Sasa spp., Neyraudia reynaudiana, etc...
Ngày tải lên: 21/07/2016, 10:39
Ngày tải lên: 26/09/2015, 09:47
Đề tài " A five element basis for the uncountable linear orders " doc
... ω1 , C and C ∗ form a five element basis for the uncountable linear orders whenever X is a set of reals of cardinality ℵ1 and C is a Countryman line Notice that by our observations such a basis ... X is a set of reals of cardinality ℵ1 , then X serves as a single-element basis for the class of uncountable separable linear orders PFA is a strengthening of the Baire Category Theorem and is ... Countryman line Such a list is called a basis The simplest example of an uncountable linear order is R, the real line This object serves as the prototype for the class of linear orders and as the canonical...
Ngày tải lên: 06/03/2014, 08:21
Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx
... to cause disease These mutations are associate with early onset of the disease and has the pathology includes LBs and is autosomal dominant [21] a- synuclein a- synuclein is a small (14 kDa), highly ... to the parkinsonian neurotoxin MPTP Proc Natl Acad Sci USA 99, 14524–14529 43 Chandra S, Fornai F, Kwon HB, Yazdani U, Atasoy D, Liu X, Hammer RE, Battaglia G, German DC, Castillo PE et al (2004) ... oxidation and nitration can also increase the rate of conversion [76] Binding of polyanions to the C-terminal domain can also catalyse protein aggregation [58] Current research has suggested that...
Ngày tải lên: 07/03/2014, 10:20
Global Guidance PrinciPles for life cycle assessment databases: A Basis for Greener Processes and Products ppt
... data users, is important because data move from raw state to and through datasets and databases User feedback Networking of databases Data in the supply chain Raw data collection Database management ... prepararon artớculos temỏticos para cada 21 ỏrea y la informaciún previamente publicada fue extraớda y colocada en una base de datos para la preparaciún de dichos artớculos y para su consulta durante ... bỳsqueda intensa de datos miner a de datos-para avanzar hacia un mundo bases de datos interconectadas y una accesibilidad total a datos confiables La construcciún de capacidades es particularmente...
Ngày tải lên: 07/03/2014, 23:20
Finding Surprising Patterns in a Time Series Database in Linear Time and Space pdf
... 6e foăha9{9Dj#fD`ệo(`p$D(D9D`(Dệy 10 ba$ ba$ 11 aba $ 12 14 aba $ 13 15 aba $ 16 ba$ aba ba$ $ aba ba$ aba $ $ aba aba $ aba $ ba 18 aba aba $ ba 17 aba 19 aba w b B V ... Ô9DD1găƯ$AG(9ipA9Dgiq(Ưf#D(i34ÔDGfwcT PT X b CF B @ C B @ X eT ự E e C R S S B C V R T c(Ô9ÔGqfa#DwDcệÂujD$(Ô(YqYtă7WhÔÂG a b a a b a b a a b a a b a b a a b a b a $ $ ba 20 $ ba aba $ aba ... G ) A 43 ) & A 29âhB9o#C2{93ĂIB I âílƠ24c ) A 3 & ) Ưâl(## G3 ) A 43 ) H2aCâ#ÔeC#Ư y & $ ỏfrr V A & WaC#rƯWD & A ) A ) 2s|d1#pâ|@7fƯẹ...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: An asymmetric ion channel derived from gramicidin A Synthesis, function and NMR structure ppt
... around 222 nm (Fig 3A) indicates a random-coil structure In methanol, two positive maxima were observed at 209 and 230 nm (Fig 3A) These two maxima are characteristic of a parallel right-handed ... long-range NOEs observed can be ascribed to two types: those between aHi and NHi+6 (i ¼ 1, 3, and for chain A, and 1, 3, 5, 7, and for chain B); and those between aHi and NHi-6 (i ¼ 10 and for chain ... the standard library of dyana In the 3–Cs+ complex, chains A and B are connected head-to-head by succinic acid, in such a way that the molecule entity starts from a C-terminus and ends at another...
Ngày tải lên: 30/03/2014, 15:20
convex analysis and non linear optimization theory and examples - borwein,lewis
... call a map A : E → Y linear if any points x and z in E and any reals λ and µ satisfy A( λx + µz) = λAx + µAz In fact any linear function from E to R has the form a, · for some element a of E Linear ... historically from the calculus of variations, and has important applications in optimal control, mathematical economics, and other areas of infinite-dimensional optimization However, rather like Halmos’s ... separation and algorithmic approaches We employ a less standard technique, using our earlier analytic ideas, and leading to a rather unified treatment It relies on the relationship between the optimization...
Ngày tải lên: 31/03/2014, 15:13
facial expression classification method based on pseudo-zernike moment and radial basis function network
... pp.200-205 Javad Haddadnia, Majid Ahmadi, Karim Faez, “An Efficient Human Face Recognition System Using Pseudo Zernike Moment Invariant and Radial Basis Function Neural Network,” International Journal ... Expression Analysis using Gabor Wavelets,” World Academy of Science, Engineering and Technology 42, 2008 Daw-Tung Lin,”Facial Expression Classification Using PCA and Hierarchical Radial Basis Function ... discrimination capability (Fig.6) IV CLASSIFIER DESIGN The major advantages of RBFN over other models such as feed-forward neural network and back propagation are its fast training speed and local feature...
Ngày tải lên: 28/04/2014, 10:17
a means to an end the biological basis of aging and death apr 1999
... human death have changed dramatically during our history as a species, but maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and ... age 30 Skin and hair Loss of subcutaneous fat; appearance of wrinkles, pigmentation Graying of hair at all body sites; loss on top of head; some facial hair may increase Nails thicken Heart and ... of cancer or cardiovascular disease or a genetic disorder—increases an organism's susceptibility to disease and accidental death T h e gradual physical weakening that accompanies aging will make...
Ngày tải lên: 11/06/2014, 05:26
design and optimization of thermal systems A Series of Textbooks and Reference Books Founding ppt
... Charles A Schacht 179 Practical Engineering Failure Analysis, Hani M Tawancy, Anwar Ul-Hamid, and Nureddin M Abbas 180 Mechanical Alloying and Milling, C Suryanarayana 181 Mechanical Vibration: Analysis, ... Gears and Their Vibration: A Basic Approach to Understanding Gear Noise, J Derek Smith Chains for Power Transmission and Material Handling: Design and Applications Handbook, American Chain Association ... 194 Damage Mechanics, George Z Voyiadjis and Peter I Kattan 195 Standard Handbook of Chains: Chains for Power Transmission and Material Handling, Second Edition, American Chain Association and...
Ngày tải lên: 27/06/2014, 17:20
Assessment of capability, knowledge and skill of vocational school graduates: A basis for enhanced industryacademe cooperation
... and managers and also a heated topic in many international and national conferences Some relevant researches are as follows: 2.1 International related research Education and human resources academics ... international journals, books (about Human resources management and Vocational education and training) and articles containing related information and data have been scanned After that, the author provides ... linking company-based and school-based technical and vocational education and training, namely Germany, France, and Great Britain The results show how solutions and models adapted to the Vietnamese...
Ngày tải lên: 16/07/2014, 08:22
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot
... 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution ... Fourier, Fourier cosine and sine transforms of functions f and g has a meaning and belongs to L(R) and the factorization property holds Nguyen Xuan Thao and Nguyen Minh Khoa 424 γ F (f ∗ g)(y) = ... Transform, MC Gray Hill, NewYork, 1951 19 H M Srivastava and Vu Kim Tuan, A new convolution theorem for the Stieltjes transform and its application to a class of singular equations, Arch Math...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc
... contribution AF and LC coordinated the study Data acquisition and data analysis were done by AC, EV, GN, AF The manuscript was prepared by LC and GN All authors read and approved the final manuscript ... for AAA can be found in Fogliata et al [6] In summary, the AAA configuration phase consisted in the optimisation of parameters and calculation kernels against the measured beam data The optimisation ... Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities Alessandro Clivio, Giorgia Nicolini, Eugenio Vanetti, Antonella Fogliata,...
Ngày tải lên: 09/08/2014, 09:21
Quantitative evaluation of motor function before and after engraftment of dopaminergic neurons in a rat model of Parkinson''''s disease ppt
... unsteadiness and falling during walking In conclusion, the CatWalk-assisted automated gait analysis system revealed that unilateral infusion of 6-OHDA leads to functional changes in static and ... such as tyrosine hydroxylase (TH) and aromatic amino acid decarboxylase (AADC) [16] In the present study, we used the CatWalk-assisted automated gait analysis system to evaluate gait changes ... Technology, Wageningen, The Netherlands) before 6-OHDAlesioning or sham operation The rats that had received 6OHDA were evaluated again weeks after 6-OHDA injection and at weeks after transplantation...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Tibialis posterior in health and disease: a review of structure and function with specific reference to electromyographic studies" pot
... JW and DET critically revised the manuscript All authors read and approved the final manuscript Additional material Additional file Posterior approach A video demonstration of the posterior approach ... (TP), medial malleolus (M) and tendo Achilles (TA) Small arrow indicates rounded TP tendon proximally and large arrow indicates the flattened area of tendon in retromalleolar region as a result ... a cadaveric study Foot Ankle Int 2003, 24:780 Sarrafian S: Anatomy of the foot and ankle: descriptive, topographic, functional 2nd edition Philadelphia: Lippincott; 1993 Agur A, Dalley A: Grant's...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: " The YlmG protein has a conserved function related to the distribution of nucleoids in chloroplasts and cyanobacteria" pdf
... 5'-GACAGGTTCAGGTCATAGAAG-3' for At5g21920, 5'-TATCTGAACACTCCGTTGACGGTA-3' and 5'-CAAAGATA AACGGAATACGATC-3' for At4g27990, 5'-GCAATGGGAAGCAGTGGTGG-3' and 5'-GGGAGAAGAGACGGGTTTCG-3' for GAPDH, and ... (Takara) with oligo(dT)15 primer PCR was performed by using primers 5'-CACCGAGAAGTCAACAGCTCGGTCATCGAC-3' and 5'-TCAAGTCTTCCAATTTCTACCCAGTGCTGC-3' for AtYLMG1-1, 5'CCTCAACATATATAACACCATC-3' and ... inserted 35S-cDNA in the FOX lines, the insertion was amplified by PCR using primers 5'GTACGTATTTTTACAACAATTACCAACAAC-3' and 5'-GGATTCAATCTTAAGAAACTTTATTGCCAA-3', and then sequenced by a primer 5'-CCCCCCCCCCCCD...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... Animals, as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were ... pre- and post-raltegravir viral load measurements was done Viral load values at Day 0, Day and Day 10 were compared with viral loads at 27 and 166 days prior to treatment start Significant differences ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "A tumor cord model for Doxorubicin delivery and dose optimization in solid tumors Steffen Eikenberry" ppsx
... mouse mammary carcinomas, mouse mammary adenocarcinomas, and rat hepatomas Larger tumors typically have less vascular surface area [21], although vascular volume may stay relatively constant [31] ... from the plasma, extravasation into the extracellular space, and cellular uptake all act over different time-scales A mathematical model by El-Kareh and Secomb [3] took this into account and explicitly ... upon an individual's plasma pharmacokinetic parameters, and the range for the 12 patients reported by Robert et al [20] is displayed along with the average Peak plasma concentration changes linearly...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Patient throughput times and inflow patterns in Swedish emergency departments. A basis for ANSWER, A National SWedish Emergency Registry" ppt
... Performancedataandstatistics/AccidentandEmergency/index.htm], Accessed February 2, 2011 14 Accident and Emergency Attendances in England 2009-10 National Health Service, The Health and Social Care ... et al [35,36] A long LOS was observed in all EDs when the patients arrived between and am This was most likely caused by patient Ekelund et al Scandinavian Journal of Trauma, Resuscitation and ... manuscript FE and PT collected and analyzed the data and critically revised the manuscript FE also drafted the manuscript All authors read and approved the final version of the manuscript Competing...
Ngày tải lên: 13/08/2014, 23:20