... each LI has an ID, which matches the CSS class with the data-icon set to custom ... into an App Using PhoneGap You have spent all this time building a great website using jQuery Mobile What about real apps? You can choose to learn Objective-C, Java, and C#, or you can leverage ... • Grid: data-icon=“grid” • Star: data-icon=“star” • Alert: data-icon=“alert” • Info: data-icon=“info” • Home: data-icon=“home” • Search: data-icon=“search” The following navigation bar shows...
Ngày tải lên: 29/04/2014, 15:25
... in Dreamweaver CS5.5 are aimed at web designers and developers who are already comfortable with HTML and CSS It also helps to have at least a basic understanding of JavaScript and some jQuery ... for other mobile operating systems, such as BlackBerry, later Chapter describes how to package a web application built with HTML, CSS, and JavaScript for deployment as a native app on Android ... using PhoneGap PhoneGap is an open-source framework that allows you to author native apps without the need to learn Java or Objective-C Dreamweaver CS5.5 automatically installs PhoneGap and simplifies...
Ngày tải lên: 06/03/2014, 03:20
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... detected with the molybdate reagent, reducing sugars, with aniline hydrogenphthalate; and ribitol and monosaccharides, with 5% (w/v) AgNO3 in aqueous ammonia Acid hydrolysis was carried out with ... & Matthysse, A. G (1997) Attachment of Agrobacterium tumefaciens to carrot cells and Arabidopsis wound sites is correlated with the presence of a cell-associated, acidic polysaccharide J Bacteriol ... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component of the cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined...
Ngày tải lên: 17/03/2014, 10:20
dreamweaver cs5.5, designing and developing for mobile with jquery html5 and css3 (2011)
... in Dreamweaver CS5.5 are aimed at web designers and developers who are already comfortable with HTML and CSS It also helps to have at least a basic understanding of JavaScript and some jQuery ... for other mobile operating systems, such as BlackBerry, later Chapter describes how to package a web application built with HTML, CSS, and JavaScript for deployment as a native app on Android ... using PhoneGap PhoneGap is an open-source framework that allows you to author native apps without the need to learn Java or Objective-C Dreamweaver CS5.5 automatically installs PhoneGap and simplifies...
Ngày tải lên: 21/03/2014, 11:45
Adobe Dreamweaver CS5.5 Studio Techniques: Designing and Developing for Mobile with jQuery, HTML5, and CSS3 ppt
... in Dreamweaver CS5.5 are aimed at web designers and developers who are already comfortable with HTML and CSS It also helps to have at least a basic understanding of JavaScript and some jQuery ... for other mobile operating systems, such as BlackBerry, later Chapter describes how to package a web application built with HTML, CSS, and JavaScript for deployment as a native app on Android ... using PhoneGap PhoneGap is an open-source framework that allows you to author native apps without the need to learn Java or Objective-C Dreamweaver CS5.5 automatically installs PhoneGap and simplifies...
Ngày tải lên: 27/06/2014, 05:20
dreamweaver cs6 mobile and web development with html5, css3, and jquery mobile
... Pereira Dennis John Copy Editors Alfida Paiva Insiya Morbiwala Laxmi Subramanian Sajeev Raghavan Aditya Nair www.it-ebooks.info About the Author David Karlins is a web design consultant, teacher, and ... laptops, tablets, and smartphones Chapter 7, Creating Mobile Pages with jQuery Mobile, is about creating pages based on jQuery Mobile accessible, inviting, and animated pages that work particularly ... illustrates applying an h3 tag to a selected line of text Adding paragraphs, lists, and links By default, the content you enter in the Document window has paragraph tags added to apply paragraph...
Ngày tải lên: 01/08/2014, 17:20
A simple introduction to working with LVM
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... that the test partition is full and we want to make it bigger First of all we can look at how big it is at the moment with lvdisplay: root@lappy:~# lvdisplay - Logical volume LV Name VG Name...
Ngày tải lên: 18/09/2012, 10:12
Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"
... chloroform and ml TEA at 0-5 °C After h at room temperature, the solution was washed with water, N HCl and again with water The organic layer was dried over Na2SO4 and evaporated The residue was purified ... coloured and maintained for h at room temperature Then the organic phase was washed with water, followed by 1N HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting ... prostate cancer metastasis Mol Aspects Med 2010 Apr;31(2):205-14 Zanardi LA, Battistini L, Burreddu P, et al Targeting alpha(v)beta(3) Integrin: Design and Applications of Monoand Multifunctional RGD-Based...
Ngày tải lên: 25/10/2012, 11:40
OReilly.Building.a.Web.2.0.Portal.with.ASP.NET.3.5.Jan.2008-BBL
... Data access layer Encapsulates database access and provides an interface that is database and data source independent It also provides object factories that create Entity classes out of database ... compared to non-Ajax web portals Using ASP.NET AJAX The web portal you’ll learn how to build is an N-tier application with a user interface (UI) layer, a business layer, and a data access layer ... with the database DatabaseHelper is a class used for performing common database operations DashboardDataContext is generated by LINQ to SQL and maps entities to database tables Data Model To...
Ngày tải lên: 15/11/2012, 14:24
OReilly - jQuery Mobile
... have a data- attribute and: a Adds theming classes b Adds appropriate ARIA role and aria-level attributes c Adds a back button to the header (if there isn’t one already in the markup) for pages ... pages and dialogs in the application Each page (that is to say, each element that has a data-role="page" attribute) will have its own unique URL within the application, allowing for bookmarking and ... to embed data into valid HTML markup jQuery Mobile has a large vocabulary of data- attributes Upon initialization, jQuery Mobile selects elements based on their data- attributes and enhances them...
Ngày tải lên: 03/01/2013, 09:10
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil
... low value lipids as feed stocks: Vegetable oil soap stock, Fuel Processing Technology 86 (2005): 1087 – 1096 Sukumar Puhan, Vedaraman N, Ramabrahamam B.V, Nagarajan.G, Mahua (Madhuca indica) seed ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... fuels at all loads This is already explained that the brake thermal efficiency can be considered as a reciprocal of the BSEC At all loads the engine with diesel operation shows a higher and with...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch
... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... zero to rated voltage within the current rating of the device This also means that the series voltage injection capability stays constant even with varying frequency A major advantage with the ... mode the capacitor voltage goes to zero during each cycle As a result of the control, the MERS can act as a variable capacitor The size of the capacitive injected series voltage can be varied from...
Ngày tải lên: 15/10/2013, 16:11
Tài liệu 20 Terabytes a Night by Doug Rosenberg with Matt Stephens doc
... database enables a diverse multidisciplinary research program: astronomy & astrophysics; machine learning (data mining); exploratory data analysis; extremely large databases; scientific visualization; computational science & distributed computing; and ... * Calibration, configuration, processing, and provenance metadata Sky Movies—Challenges of LSST Data Management The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with ... the magic questions are: What happens? And then what happens? (repeat as necessary) What else can happen? (repeat as necessary) These questions work well for capturing algorithms, too 31 the lab portion of the workshop, our friend superCoder was standing up at the whiteboard ...
Ngày tải lên: 13/12/2013, 00:15
pro jquery mobile
... controls to manage our mobile applications data www.it-ebooks.info 37 Chapter Navigating with Headers, Toolbars, and Tab Bars All mobile applications need toolbars to help navigate or manage data on ... your mobile apps accessibility with WAVE it is also valuable to physically test your Mobile Web application with an actual assistive technology For example, if you have an iOS device, activate Apple’s ... NOTE: Any link with data-rel="dialog" or any page with data-role="dialog" will not appear in history and cannot be bookmarked For example, if you navigate to a dialog, close the dialog and then tap...
Ngày tải lên: 27/12/2013, 16:49
Tài liệu jQuery Mobile Web Development Essentials docx
... anything at all An example: Normal, non-special link< /a> As we saw in Chapter 1, Preparing Your First jQuery Mobile Project, jQuery Mobile makes heavy use of data ... PhoneGap project to create real native applications Chapter 13, Becoming an expert Build an RSS Reader application, expands upon the previous chapter by creating an application that lets you add and ... (faizfattohi@gmail.com) Credits Authors Raymond Camden Andy Matthews Reviewers Md Mahmud Ahsan Shameemah Kurzawa M Ali Qureshi Joe Wu Acquisition Editor Usha Iyer Lead Technical Editor Dayan...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu jQuery Mobile Cookbook ppt
... Pages and Dialogs Writing a single-page template application In a single-page template application, each page of the application will have its own HTML file A page is wrapped within a page container ... data-role="page"> page container is optional in a single-page template application The page contents are automatically wrapped with a page container by the jQuery Mobile framework Always use a ... using Ajax with CSS3 animation The current page is then hidden from view A Dialog is a page having the data-role="dialog" attribute You can also load a page as a dialog by adding the data-rel="dialog"...
Ngày tải lên: 15/02/2014, 07:20
Tài liệu Báo cáo khoa học: A novel dicyclodextrinyl diselenide compound with glutathione peroxidase activity ppt
... mitochondria was analyzed by thiobarbituric acid assay [34] In this assay, thiobarbituric acid reacts with malonaldehyde and or other carbonyl by-products of free-radicalmediated lipid peroxidation ... which contained a certain concentration of 6-CySeCD, was apparently decreased compared with the damage group, and the mitochondrial swelling decreased with increasing Table Kinetic parameters of ... state selenolate in the catalytic cycle We believe that this is signicant when designing mimics with high catalytic efciency Experimental procedures Apparatus and materials Structural characterization...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... cross-react with antibodies against plant helicases including PDH45 and PDH65 and also against human DNA helicases I, II, III and IV (data not shown) ssDNA-dependent ATPase activity was present at a ... 2A, lane 4) and ssDNA-dependent ATPase activity (data not shown) sedimented together between alcohol dehydrogenase and BSA (fraction 11) and gave a molecular mass of 120 kDa with a sedimentation ... substrates (Fig 5G and H) were prepared as described previously [11,15] 32 ATP-dependent DNA helicase and DNA-dependent ATPase assays The standard DNA helicase reaction was performed in a 10-lL reaction...
Ngày tải lên: 20/02/2014, 11:20
Bạn có muốn tìm thêm với từ khóa: