... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over ... pounds from a < /b> bank a < /b> crime b criminal c criminally d criminality > b 178 your own business can cause a < /b> lot of financial worries a < /b> Manage b Managing c Manager d Manageable > b 179 The surgeons...
Ngày tải lên: 05/11/2012, 09:18
... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... for LlCBP3 3A < /b> at pH 6.0 (A,< /b> B) Binding of LlCBP3 3A < /b> visualized by SDS-PAGE (A)< /b> LlCBP3 3A < /b> present in the supernatant after 24 h of incubation with a-< /b> chitin (lane 2), b- chitin (lane 3), Avicel (lane ... incubation FEBS Journal 276 (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a-< /b> and < /b> b- chitin The degradation rates of a-< /b> and < /b> b- chitin were assayed...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed ... (Tubingen, Germany), and < /b> all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a-< /b> and < /b> b- domains The individual a-< /b> and < /b> b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA ... Zn4aMT and < /b> Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a)< /b> Asn (a)< /b> Asn (b) Cys (a)< /b> Cys (b) Asn 23 (b) a-< /b> Domain Lys (NH) Lys (a)< /b> ...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> the BR quantum yield for the a < /b> subunits ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2,...
Ngày tải lên: 16/03/2014, 14:20
The a and b adapters are used as priming sites for both amplification
... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...
Ngày tải lên: 19/03/2014, 22:32
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx
... flax leaves Galactolipids were separated and < /b> purified as described in Materials and < /b> methods EDE content was measured by UV absorbance of MGDG and < /b> DGDG fractions at 267 nm Average values and < /b> standard ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis thaliana Tetrahedron ... mass spectral data This work was supported in part by Grant 09-04-01023 -a < /b> from the Russian Foundation for Basic Research and < /b> a < /b> grant from the Russian Academy of Sciences (program ‘Molecular and...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and < /b> vacuolar...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt
... water for each Partial acetylation of serines and < /b> threonines was avoided by adding 12 lL of a < /b> solution containing 0.5 mm hydroxylamine and < /b> 100 mm NaOH to the reaction chamber and < /b> incubating at ... [28,29] Although a < /b> general stromal processing peptidase (SPP) has been characterized, and < /b> a < /b> preferred consensus sequence for cleavage between a < /b> basic amino acid (arginine or lysine) and < /b> a < /b> C-terminal ... and < /b> potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A)< /b> In addition, the alkali metal adducts...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland, ... intestine Caecum Large intestine Pancreas Parotid gland Submaxillary gland Liver Trachea Lung Kidney Urinary bladder Ovary Uterus Testis Seminal vesicle Thyroid gland Parathyroid gland Brain Muscle...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... antagonism on prostaglandin and < /b> leukotriene synthesis in glomerular immune injury J Laboratory Clin Med 134, 478–482 Ushikubi, F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, ... 45 by up-regulating the synthesis and < /b> release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Lianos, E .A < /b> & Bresnahan, B .A < /b> (1999) Effect of thromboxane A2< /b> inhibition and < /b> ... DNA polymerase, T4 DNA ligase and < /b> calf intestinal alkaline phosphatase were obtained from Roche Molecular Biochemicals, Sussex, UK Nytran supercharge membrane (0.45 lm) was from Schleicher and...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... Journal 2007, 4:102 http://www.virologyj.com/content/4/1/102 A < /b> HindIII XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... Journal 2007, 4:102 http://www.virologyj.com/content/4/1/102 A < /b> HindIII XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI...
Ngày tải lên: 20/06/2014, 01:20
2000 Test exam with A and B docx
... are tall a < /b> the b a < /b> c an d no article > d 54 Hoa is good pupil a < /b> the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class ... pounds from a < /b> bank a < /b> crime b criminal c criminally d criminality > b 178 your own business can cause a < /b> lot of financial worries a < /b> Manage b Managing c Manager d Manageable > b 179 The surgeons ... being started by hand But now they are started by electricity a < /b> used b being c But now d are > b 33 This house is often broken off and < /b> a < /b> lot of things are taken away a < /b> is b broken c off d away ...
Ngày tải lên: 26/07/2014, 10:20
Báo cáo toán học: "Parking functions of types A and B" ppsx
... from some factorization (a1< /b> b1 ) (an bn ), then bn = an + as we just saw But (a1< /b> , , an−1 ) is a < /b> non-decreasing parking function of length n − Since a1< /b> , , an−1 ≤ an , relabeling an + 2, ... gives an algorithm for associating a < /b> factorization to any parking function In particular we not use the fact that these two sets have the same number of elements First we remark that there is a < /b> natural ... type B case will be very similar The map from factorizations to parking functions is straightforward, but given a < /b> parking function, finding the associate factorization is not obvious The proof below...
Ngày tải lên: 07/08/2014, 06:23
Báo cáo y học: " Hemoglobin a and b are ubiquitous in the human lung, decline in idiopathic pulmonary fibrosis but not in COPD" potx
... Membranes were probed with goat anti-Hemoglobin alpha (Hba) antibody (H80: sc-21005, Santa Cruz Biotechnology, Inc Santa Cruz, CA) or mouse antiHemoglobin beta (Hbb) antibody (M02, Abnova, Taipei, ... exchange are disturbed Page 11 of 13 Additional material Additional file 1: Table S1 Detailed data of the morphometrical analysis of Hba and < /b> Hbb positive area (sum of the bronchial/alveolar epithelium ... The bands were similar in the BALF and < /b> sputum supernatants as confirmed with the Hba and < /b> Hbß antibodies i.e there was the presence of complexes containing both Hba and < /b> Hbß i.e tetramers in both...
Ngày tải lên: 12/08/2014, 11:22
Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues
... plants, also known as Roxburghia They are found in South Asia, Malaysia and < /b> North Australia and < /b> are classified as subshrubs, or twining herbs, with thick and < /b> tuberous roots.5 This family can be divided ... more that I could ask for xviii LIST OF ABBREVIATIONS Ac………………… acyl Acac…………………acetylacetonate AIB………………….α-aminoisobutyric acid AIBN……………… 2,2’-azobis(2-methylpropionitrile) ATR…………………Attenuated ... stay grounded and < /b> been a < /b> source of unwavering support over the years In particular, I want to thank my cousins Alanna and < /b> Camilla Mingay I think that I found the best travel companions ever and...
Ngày tải lên: 23/08/2015, 17:30
A STUDY IN THE SELECTIVE POLYMORPHISM OF a AND b GLYCINE IN PURE AND MIXED SOLVENT
... Morphologically Important BFDH Bravais-Friedel-Donnay-Harker rule BCF Burton-Cabrera-Frank theory PBC Periodic Bond Chain analysis ISA Interface Structure Analysis SCF Self-Consistent Field SAM Self-Assembled ... microscopy and < /b> x-rays (Fig 1.1) As a < /b> result, detailed rule-of-the-thumb knowledge and < /b> heuristics are available on the relationship between crystal growth and < /b> parameters such as temperature, supersaturation ... problem becomes computationally intractable We will show in a < /b> later part of the thesis, however, that it is possible to obtain reasonable solutions by making suitable approximations In particular,...
Ngày tải lên: 10/09/2015, 09:11
Electrical, dielectric and magnetocaloric properties of selected a and b site substituted manganites
... Mr Prasanta Sahani, Mr Sashi Bhusan Rout, Mr Satyananda Kar, Mr Satyananda Barik, Mr Rajeeb kumar Jena, Mr Narahari Mahanta, Mr Bijay Kumar Das, Mr Satyanarayan Bhuyan, Mr Manish Singh and < /b> other ... in-law (Mrs Golap Manjari Behera), Brothers (Dr Subrat Kumar Barik and < /b> Mr Ratikanta Barik), Sisters (Mrs Saroj Bala Barik, Mrs i ACKNOWLEDGEMENTS Bandana Mahakud and < /b> Mrs Sujata Biswal), Brother-in-laws ... Brother-in-laws (Mr Dibakar Barik, Mr Manoranjan Mahakud, Dr Ramesh Biswal and < /b> Mr Kharabela Behera), sister in laws (Mrs Tanaya Barik and < /b> Mrs Rebati Barik) and < /b> nephews (Sonu, Sanjib, Guddu, Tutu, Prachi,...
Ngày tải lên: 10/09/2015, 15:52
Palladium (II) catalyzed 5 endo epoxynitrile cyclizations total syntheses of enokipodins a and b
... of DIPEA or absence of base afforded no cyclization products (Table 1, entries 13 and < /b> 14) This way, it was established that both base nature and < /b> metallic counter-ion are essential to achieve good ... Nuria Esterau, (a)< /b> Ishikawa, N K.; Yamaji, K.; Taharab, S.; Fukushi, Y.; Takahashi, K Phytochemistry 2000, 54, 777; (b) Ishikawa, N K.; Fukushi, Y.; Yamaji, K.; Tahara, S.; Takahashi, K J Nat Prod ... acquiring spectral data Supplementary data Scheme Preparation of precursor Supplementary data (experimental procedures and < /b> spectral data for compounds 1–2, 7, 8a< /b> b, 13) associated with this article...
Ngày tải lên: 26/01/2016, 10:44