... it – e.g an adjective or an intensifier – the article goes before the first modifier: “It was a great party.” “My grandma had a really lovely day.” For more fun tests, quizzes and games log onto ... www.englishbanana.com now! English Banana.com Test Your Grammar Skills When to Use Articles – a / an & the • Uncountable nouns don’t need an article in front of them: “Would you like wine with your meal, ... English Banana.com Test Your Grammar Skills When to Use Articles – a / an & the • Compare the following two sentences: “I’m going to the cinema later.” You both know which cinema – probably the one...
Ngày tải lên: 20/08/2015, 08:25
29369 a and an and the
... should you use? A or An? cat chair _ orange dress _ bed _ idea _ blue eye _ book umbrella animal green apple ESL teacher (English as a second language) ...
Ngày tải lên: 31/08/2016, 20:24
Bài tập thực hành với A/AN và THE(phần 4) doc
... what they believe are _ advantages and disadvantages there a a b an c the d no article is needed 14 Look in _ locker room, workout room, and shower–everywhere should be clean a a b an c the ... instructors and personal trainers a a b an c the d no article is needed 10 They should be educated in physical education or certified by _ organization such as the American Council on exercise a a b an ... article is needed 12 You should evaluate _ equipment and make sure fitness machines are modern and in working order a a b an c the d no article is needed 13 Try to talk to other members of the...
Ngày tải lên: 12/07/2014, 05:21
Văn phạm: Countable nouns with a/an and some pdf
... in Britain carry guns, but most of them don't Một vài cảnh sát Anh có mang theo súng, phần lớn không A and the A Hãy xét ví dụ sau: I had a sandwich and an apple for lunch Tôi dùng bánh sandwich ... sandwichÚ, the appleÚ Karen biết nói tới bánh táo Ũ bánh táo mà dùng b a tr a Hãy so sánh a the ví dụ sau: A man and a woman were sitting opposite me The man was American but I think the woman was British ... cho b a tr a Ổ John nói a sandwichÚ, an appleÚ lần anh nói tới chúng The sandwich wasn't very good but the apple was nice Chiếc bánh sandwich không ngon lắm, táo tuyệt Ổ John nói the sandwichÚ,...
Ngày tải lên: 31/07/2014, 18:20
Báo cáo y học: "Associations between the HLA-A polymorphism and the clinical manifestations of Behcet’s disease" pps
... disease manifestations, management, and advances in treatment Nat Clin Pract Rheumatol 20 07, 3:148-155 Mizuki N, Ota M, Kimura M, Ohno S, Ando H, Katsuyama Y, Yamazaki M, Watanabe K, Goto K, Nakamura ... HLA -A alleles; there was no significant HLAA allele associated with BD in Palestine, Jordan, Iran, Ireland, Italy, and Turkey [27 -31] The low phenotypic frequencies of HLA -A* 02: 07, A* 26 :01, and ... effect of HLA -A* 02: 07 and A* 26 :01 and their genetic interaction with HLA-B*51 on these clinical manifestations (Table 5) There was a trend that HLA-B*51 and HLA -A* 02: 07 are additive to All subjects...
Ngày tải lên: 12/08/2014, 15:22
Cách dùng mạo từ a, an và the pptx
... and toast A an B a C the D × What time you start work in the morning? A an B a C the D × Barbara hopes to go to university next year A an B a C the D × They went on a cruise down Nile and ... 12 I’ve noticed that Spanish eat a lot of vegetables A an B a C the D × 13 A volcano has erupted in .Philippines recently A an B a C the D many 14 examinations always make him nervous A an ... Ontario A the B × C a D an The explorer crossed .Pacific Ocean in a canoe A an B a C the D no article She has been playing flute for ten years A an B a C the D × For breakfast we usually have ...
Ngày tải lên: 13/08/2014, 06:20
A, AN, ONE, THE (With Keys)
... 9A, - 10 a, a; a, an II a, a; -: a, - ,a 12- , an, an; - 13 a, a; a; a, a 14-, an 15 A, a; a; a, a 16 an, a; -, an, -, a, a 17 a, -; a, 18- ,a 19 a; a, - 20 a, a; a; - 21 A; a, an; a 22 - ,a, an, a 23 - ,a, ... 23 - ,a, an 24 a, -; a 25 a: a, a 26 a, a: - 27 an, a, ,- 28 -;- 29 a, a, -,30 an; a, a, a: a; -I 31 a, a; an, a 32 a, a, a, a 33- ,a, a 34 a, a 35 a, a 36- ,a B (As before '-' indicates that no article ... normally the preferred answer.) a, the; a, a an, the, the a, the, -,- the, a, the, -.-. (the) a, - ,the, a a, a/ the, an, the a, -, an, the, the, the, the a, the, the a, a 10 the, the, the, the, an 11-...
Ngày tải lên: 29/10/2014, 11:00
Diferences between a few and the few
... here Answers He wants to spend the few days that are left to him in solitude and meditation I have got a few questions to ask The few public gardens that we have are not maintained properly I can’t ... ………………………………… remarks that he made were very poignant a) a few b) the few c) either could be used here Question When I met him ……………………………………… weeks ago, he looked happy a) a few b) the few c) either could ... can’t express my gratitude in a few words The few remarks that he made were very poignant When I met him a few weeks ago, he looked happy Be first to know when grammar rules change! Sign up to...
Ngày tải lên: 10/07/2015, 22:27
A an và the
... I saw a film last night The film was about a solider and a beautiful girl The solider was in love with the girl but the girl was in love with a teacher So the solider shot the teacher and married ... này) • The postman was late this morning.(=our usual postman) 2/ 4 A/ An The (Sáng người đ a thư đến trễ) (người đ a thư thường chúng tôi) • I took a taxi to the station.(= the station of that town) ... Chúng ta nói the docter, the dentist • John isn’t very well He has gone to the doctor (=his doctor) (Jonh không khoẻ Anh ta bác sĩ.) (bác sĩ riêng anh ta) Sau số thí dụ khác: • There was a man talking...
Ngày tải lên: 14/01/2016, 15:31
The story of a seagull and the cat who taught her to fly luis sepulveda
Ngày tải lên: 25/08/2016, 23:24
Perfect Rigour A Genius And The Mathematical Breakthrough Of The Century
... mathematics left the realm of abstract conversation and suddenly made itself indispensable What ultimately saved Soviet mathematicians and Soviet mathematics was World War II and the arms race ... understand, making the mathematical conversation a code that was indecipherable to an outsider; and worst of all, mathematics laid claim to singular and knowable truths when the regime had staked ... Explaining what makes mathematics as important and as beautiful as mathematicians know it to be, the Russian algebraist Mikhail Tsfasman said, “Mathematics is uniquely suited to teaching one to...
Ngày tải lên: 08/11/2016, 11:56
A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school
... interested in talking and positively participate in speaking activities -Language is of an acceptable level: this means that the language used by teachers and learners to express their ideas and thoughts ... manager of the class The teacher can teach anything they find necessary and students are only the listeners Students have to what their teacher tells them Teacher can ask students questions and ... the most popular languages nowadays and the aim of learning a language is to communicate 30 with people Meanwhile, one of the interviewees reluctantly answers that it is rather important because...
Ngày tải lên: 07/11/2012, 14:44
Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx
... folate, and colon Page 20 of 21 (page number not for citation purposes) Nutrition Journal 20 04, 3:19 20 5 20 6 20 7 20 8 20 9 21 0 21 1 21 2 21 3 21 4 21 5 21 6 21 7 21 8 21 9 22 0 22 1 22 2 22 3 22 4 cancer in ... who recently had a colon polyp removed, Japanese-Hawaiians, North American Caucasians, native rural Japanese, and rural native Africans Lactobacillus species and Eubacterium aerofaciens, both ... and cancer prevention: mechanisms of action and applicability to humans Annu Rev Med 20 03, 54:131-1 52 Epub 20 01 Dec 20 03 Dirx MJ, Zeegers MP, Dagnelie PC, van den Bogaard T, van den Brandt PA:...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... incubated further for 120 At the times indicated, the adenylic charge, ATP and inosine were determined as described in Materials and methods H2O2 evokes a decrease and an increase in the intracellular ... after treatment of yeast with H2O2 and menadione Here, mitochondrial proteins (E2 subunits of both pyruvate kinase and a- ketoglutarate dehydrogenase, aconitase and heat shock protein 60) and the cytosolic ... E6 and E7 were as in Torrecilla et al [3]; those for E2 and E8 are indicated in the text and Table kinetic constants taken from the literature are compiled in Table As a representative example,...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20