a amp 946 immunotherapy prevents or reduces ad pathology and improves behavioral deficits in transgenic mouse models of ad

Sequential effects of a high fat, calorie dense diet or a high fiber diet on gene expression, body weight and associated metabolic responses in c57 BL6J mice

Ngày tải lên : 12/09/2015, 08:20

... molecules of linked tags are then cloned and sequenced The relative abundance of a particular tag is a measure of the abundance of the corresponding mRNA in the original RNA sample and as such it is a ... insulin resistance and related inflammatory disorders (Tilg and Moschen, 2006) Although both the liver and the adipose tissue play important roles in maintaining energy balance and contributing ... it involves a great amount of PCR reactions In addition, separately obtained data sets cannot readily be compared, which is in contrast to SAGE and microarray data With SAGE, ‘tags’ – pieces of...

228
231
0

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngày tải lên : 16/02/2014, 06:20

... Grenadines, Trinidad and Tobago, and the Turks and Caicos Islands ADBI Working Paper 380 Prada Source Global Development Finance World Development Indicators from World Bank Data and Annual Reports ... 18 ADBI Working Paper 380 Prada in organizing seminars to exchange information and provide technical cooperation Harmonizing approaches and coordinating areas of support could increase the capacities ... Bank, CABEI = Central American Bank for Economic Integration, CAF = Andean Corporation of Finance, NIB = Nordic Investment Bank, BLADEX = Foreign Trade Bank of Latin America, FONPLATA = Financial...

35
481
0

314 CMR 9.00: 401 WATER QUALITY CERTIFICATION FOR DISCHARGE OF DREDGED OR FILL MATERIAL, DREDGING, AND DREDGED MATERIAL DISPOSAL IN WATERS OF THE UNITED STATES WITHIN THE COMMONWEALTH potx

Ngày tải lên : 15/03/2014, 16:20

... operator of a dredged material placement or disposal facility may be required to establish or obtain, and continuously maintain, financial assurance that is adequate to assure the Department that ... flow paths, and treating stormwater at its source, maximizing open space, minimizing disturbance, protecting natural features and processes, and /or enhancing wildlife habitat Fastland Land above ... Wetlands Protection Act Normal maintenance and improvement of land in agricultural or aquacultural use that is exempt from the Wetlands Protection Act, as defined and performed in accordance...

34
983
0

Working pAper series no 1041/ A pril 2009: An economic cApitAl model integrAting credit And interest rAte risk in the bAnking book doc

Ngày tải lên : 29/03/2014, 13:20

... implications of an infinitely fine-grained portfolio All exposures are assumed to be non-tradable and held to maturity using book value accounting In line with accounting standards, assets and liabilities ... as large as in the base case 25 In both cases the repricing characteristics of assets, the portion of non interest bearing assets and liabilities and all additive spreads are kept as in the baseline ... look at dynamic optimal portfolio allocation for a corporate bond portfolio They simulate correlated interest rates and credit spreads as well as defaults and track future portfolio valuations As...

57
1.2K
0

báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx

Ngày tải lên : 19/06/2014, 22:20

... protein standards, internal controls and blanks were always assayed at the same time and in the same way All samples were always determined in triplicate and in a blind fashion Immunoblot analysis ... [9,16,17] In brief, a known amount of the internal standard is added to each sample, after solid phase extraction samples are derivatized and purified by thin layer chromatography, and finally analyzed ... performed in a coded fashion Statistical analysis Data are expressed as mean ± standard error of mean (S.E.M.), analyzed by analysis of variance (ANOVA), and subsequently by student unpaired 2-tailed...

9
490
0

báo cáo hóa học: " Expression profiles for macrophage alternative activation genes in AD and in mouse models of AD" pptx

Ngày tải lên : 19/06/2014, 22:20

... populations All normal individuals were diagnosed as Braak and Braak stage while AD individuals were diagnosed as Braak and Braak stage IV or V For each specimen, cortical gray matter was carefully ... profiles in mouse models of AD and of cerebral amyloid angiopathy Our data demonstrate that genes typical of alternative activation are clearly expressed in AD and in a mouse model of amyloid deposition ... macrophages have been identified and include classically activated macrophages that are proinflammatory and associated with the "killing" phase of the innate immune response and alternatively activated...

12
512
0

Báo cáo y học: "Early Effects of anti-inflammatory [1, 2, 4]triazolo[4, 3-a] [1, 8]naphthyridine derivatives on human stimulated PMN and endothelial cells: an in vitro study" doc

Ngày tải lên : 11/08/2014, 08:21

... demonstrated stronger analgesic activity in the writhing test in mice, remarkably lower anti-inflammatory activity in the carrageenininduced paw edema assay in rats (being active only at the highest ... The authors showed that compound NF161 (Fig 1) exhibited potent statistically-significant antiinflammatory activity at the carrageenan-induced paw edema assay in rats, and showed interesting anti-aggressive ... with a non-linear regression model using the software Origin version 6.0 (Microcal Software, Northampton, USA) IC50 data in Figures and were analyzed using one-way analysis of variance, followed...

11
453
0

Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Ngày tải lên : 12/08/2014, 01:22

... design of the study and analysis and interpretation of data HB conceived of the study, participated in its design and coordination and helped to draft the manuscript All authors read and approved ... carried out the molecular and cellular studies and drafted the manuscript DR carried out the in vivo and cellular assays and analysis and interpretation of data, EJM, MW and CL participated in ... for RNA standard generation, cDNA synthesis and QPCR Primer Sequence In vitro standard external positive sense TCCAGCAAATACACCATCCA In vitro standard external negative sense CTGCTTCACCACCCAATTTT...

11
348
0

Báo cáo y học: "A structural constraint for functional interaction between N-terminal and C-terminal domains in simian immunodeficiency virus capsid proteins" ppsx

Ngày tải lên : 13/08/2014, 01:20

... 78:2581-2585 Matano T, Kobayashi M, Igarashi H, Takeda A, Nakamura H, Kano M, Sugimoto C, Mori K, Iida A, Hirata T, Hasegawa M, Yuasa T, Miyazawa M, Takahashi Y, Yasunami M, Kimura A, O’Connor DH, Watkins ... virological analyses in vitro MY and HS performed structure modeling analyses HY and MK examined viral genome sequences NI and TM analyzed the data and wrote the paper All authors read and approved ... change in the former and purine-to-pyrimidine (adenine-to-thymine) change in the latter The appearance of additional GagV340M mutation in SIVmac239Gag205E passaged in cell culture as well as the...

10
365
0

Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt

Ngày tải lên : 13/08/2014, 09:21

... of Biology, Padua) for technical assistance in the preparation of figures, members of the Jeang laboratory for critical reading of manuscript, and Anthony Elmo for preparation of manuscript References ... that in the presence of the Tax (B) the incorporation signals are far greater than those in the absence of Tax (A) Note that many MN are seen to contain in situ incorporation signals Page of ... studies have shown that upon DNA damage, PARP-1 (a nuclear enzyme which catalyzes the polyADP-ribosylation of target proteins in response to DNA damage) and Ku proteins are rapidly activated and compete...

10
356
0

Báo cáo y học: "Cardiorespiratory effects of spontaneous breathing in two different models of experimental lung injury: a randomized controlled trial" doc

Ngày tải lên : 13/08/2014, 11:23

... Eva-Maria Hedin, Anne Abrahamson, and Agneta Roneus, all technicians at the Department of Clinical Physiology, and the x-ray laboratory team (Marianne Almgren, Ann Erikson, and Ewa Larsson, all ... (ALI) (Table S1 in additional data file) was tested only against baseline ALI (BL-ALI) Post hoc testing was always performed if a significant F ratio for a factor or the interaction of factors ... participated in the design of the study and performed measurements and the statistical analysis UG analyzed data and helped draft the manuscript AM participated in the study design and coordination and organized...

13
305
0

a study on difficulties and strategies in english-vietnamese translation of advertising slogans = nghiên cứu các khó khăn và chiến lược cho việc dịch anh-việt khẩu hiệu quảng cáo

Ngày tải lên : 02/03/2015, 14:20

... style of the original A translation should possess the style of the translator A translation should read as a contemporary of the original A translation may never read as a contemporary of the translator ... translation must give the words of the original A translation must give the ideas of original A translation should read like an original work A translation should read like a translation A translation ... of a text originally in one language into an equivalent text in a different language retaining, as far as possible, the content of the message and formal features and the roles of the original...

88
3.3K
20

a study on difficulties and strategies in english-vietnamese translation of advertising slogans = nghiên cứu các khó khăn và chiến lược cho việc dịch anh-việt khẩu hiệu quảng cáo t

Ngày tải lên : 02/03/2015, 14:20

... vocabulary features and rhetorical devices and faithful to the organization of message and spirit of original slogans It can come to a conclusion that the adaptation and free methods are preferable ... significant findings have been discovered are: translating ad slogans, especially translating puns or wordplays, are interesting but challenging Thus, translators tend to be flexible and creative in ... significant characters of the subject- ad slogans The research begins with comparison and quantitative and qualitative analysis of 100 ad slogans and equivalents under three categories: lexical, structure...

6
1.5K
53

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Ngày tải lên : 08/03/2014, 09:20

... transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial strains and plasmids ... immunoprecipitated with antiserum directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig 4B, lane 1) In addition, cross-linking adducts of 220 kDa and ... supernatant, at least three major crosslinking adducts, of apparent molecular mass 110, 65 and 55 kDa, could be detected (Fig 4A, lane 5) In addition, several cross-linking adducts of low...

8
546
0

Critical Chain: A New Project Management Paradigm or Old Wine in New Bottles? pdf

Ngày tải lên : 16/03/2014, 01:20

... mean investing in IT infrastructure, additional management training, etc In certain cases, elevating the system constraints may be carried out by the of oading mechanism, i.e., assigning some of ... non-critical chain activity may set off a cascading effect that delays the start of a critical chain activity (see Herroelen and Leus, 2001) Behavioral Issues The planning tactics of CC assume that ... execution of projects The Apollo program in the 1960s and 70s was perhaps the first to define and standardize the organizational configuration and leadership side of managing projects (Morris and Pinto,...

15
531
0

A study in the growth mechanism of silicon nanowires with or without metal catalyst

Ngày tải lên : 16/03/2014, 15:09

... Metal-assisted growth of SiNWs A basic aspect of the VLS mechanism is the metal particle acting as a catalyst for the anisotropic growth of SiNW with a crystalline structure A catalyst particle ... the catalyst This results in formation of only a few of SiNWs The reaction temperature is usually decided with the consideration of the catalyst type According to the binary phase diagram of a metal ... parameters In particular, the catalyst distribution can be well-organized by using a nano-channel-alumina (NCA) technique [11] Otherwise, the pressure of reaction channel and temperature are also important...

5
576
0

Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E afﬁnity for a mRNA cap analogue ppt

Ngày tải lên : 23/03/2014, 10:21

... amount of ligand added For the sake of comparison between various sets of data, the fluorescence decrease was normalized to Y ¼ ) (F ⁄ Fmax) At ligand saturation, a maximum for Dfmax is obtained, and ... volume After addition of the ligand, emission at 342 nm was recorded over a period suitable for reaching a constant fluorescence value (steady-state usually after min) The decrease in fluorescence ... Proc Natl Acad Sci USA 98, 7029–7036 Schaad M, Anderberg R & Carrington J (2000) Strainspecific interaction of the tobacco etch virus Nla protein with the translation initiation factor elF4E in the...

11
489
0

Báo cáo khoa học: "A Tabulation-Based Parsing Method that Reduces Copying" docx

Ngày tải lên : 23/03/2014, 19:20

... of empty categories already partially evaluated once on Rs, and RAs — an accumulator of rules already used in partial evaluation once on Es Initialize Es to empty cats of grammar; initialize Rs ... that can increase the size of the heap signiﬁcantly, and will result in a greater number of cache misses and page swaps the new algorithm also requires an off-line partial evaluation of the grammar ... is thus of some theoretical interest in that it proves that at least a constant bound is attainable within a Prolog setting It does so by invoking a new kind of grammar transformation, called EFD-closure,...

8
209
0

Social capital and Health status: a protective impact among elderly or inactive but not among active ? doc

Ngày tải lên : 28/03/2014, 20:20

... in informational costs and to a spread of health norms (Putnam 1993, 2000; Veenstra, 2000; Kawachi & Berckman, 2000; Folland 2007) Actually, by providing information, social capital enables a ... reduction of informational costs regarding, for instance, access to health care system or amenities In fostering communication among members, social capital spread health norms and may exert a social ... multidimensional character According to the WHO, a good health status means not only the absence of disease or injury but also physical, mental and social well being Mortality and morbidity indicators are...

27
465
0

the executor's guide, settling a loved one's estate or trust 3rd (2008)

Ngày tải lên : 18/04/2014, 14:12

... patiently read (and corrected) what I wrote about retirement plans Liza Weiman Hanks, an estate planning attorney of FamilyWorks law practice in San Jose, California Her energy, knowledge, and ... such as complicated investments or a family business, make a clear plan for the executor to follow Get a handle on debts Head off disputes by explaining the estate plan to family members and asking ... deadlines here and there, but for the most part you are free to take things at a pace that is manageable for you You can and should honor your own feelings and needs at the same time you honor...

540
2.1K
0