a 2 spla 2 in liposomal drug delivery

... Solubilization of single-wall carbon nanotubes by supramolecular encapsulation of helical amylose J Am Chem Soc 20 03, 125 :4 426 -4 427 Numata M, Asai M, Kaneko K, Bae AH, Hasegawa T, Sakurai K, Shinkai ... the advantage and disadvantage in the treatment of a special disease is also very important because CNT-based drug delivery system also has its indication and contraindication just like any other ... the platinum warhead In this system, a platinum complex [Pt (NH3) 2Cl2(O2CCH2CH2CO2H) (O2CCH2CH2CONH-PEG-FA) derivatized with PEG and folate (FA) was attached to the surface of SWCNT functionalized...

Ngày tải lên: 20/06/2014, 22:20

... interventions in managing chronic spinal pain Pain Physician 20 09; 12: E71- 120 Manchikanti L, Singh V, Pampati V, et al Is there correlation of facet joint pain in lumbar and cervical spine? Pain Physician ... 15 Manchukonda R, Manchikanti KN, Cash KA, et al Facet joint pain in chronic spinal pain: An evaluation of prevalence and false-positive rate of diagnostic blocks J Spinal Disord Tech 20 07; 20 : ... chronic impairing low back pain over a 14-year interval from 3.9% in 19 92 to 10 .2% in 20 06 – an overall increase in the prevalence of low back pain of 1 62% with an annual increase of 11.6% The widely...

Ngày tải lên: 26/10/2012, 09:07

... FEBS Y Zhang et al naya OA, Kolpakov FA et al (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26 , 3 62 367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, ... 422 4– 422 9 42 Shibahara S, Yoshida T & Kikuchi G (1978) Induction of heme oxygenase by hemin in cultured pig alveolar macrophages Arch Biochem Biophys 188, 24 3 25 0 43 Okinaga S, Takahashi K, Takeda ... kit (Amersham Biosciences, Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic...

Ngày tải lên: 19/02/2014, 06:20

... CK 2a in gel filtration assay rabbit anti-(human CK 2a) polyclonal IgG was used Alkaline-phosphataseconjugated anti-(rabbit IgG) Ig (Sigma, St Louis, MI, USA) was used as a secondary reagent Samples ... of interaction Filter b-galactosidase assay Growth on His– medium b-Galactosidase activity (Miller units) CK 2a( BD): CK2btes(AD**) CK 2a( BD): CK2b(AD**) CK 2a( BD): CK 2a( AD) CK 2a( BD): (AD**) CK2b(BD*): ... Western analyses with polyclonal anti-(b-galactosidase) Ig (ICN Pharmaceuticals inc., Costa Mesa, CA, USA) CA, USA) were performed according to the Stratagene protocols Drosophila CK 2a and CK2btes...

Ngày tải lên: 21/02/2014, 15:20

... incorporating a radioactive selenocysteine residue in a C-terminal Sel-tag [18] Der p carrying the Sel-tag had an intact core sequence and maintained allergen-specific IgE-binding epitopes and the use of a ... demonstrated to be dramatically increased in mice with an allergic airway in ammation, partly due to induced activity of matrix metalloproteinase-9 [31] In addition, we have previously demonstrated increased ... was altered as a result of the in ammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation In this study, we tracked inhaled...

Ngày tải lên: 07/03/2014, 21:20

... of AR in the HAT-induced biphasic ERK activation was investigated using an antiAR neutralizing antibody The HAT-induced initial ERK activation (5 after stimulation with HAT) was inhibited by a ... function HAT-induced AR release by PAR -2 and TACE as a key step in transactivating EGFR in tobacco smoke-stimulated bronchial epithelial cells [20 ] In the present study, HAT and PAR -2 AP stimulate AR ... epithelium increases in bronchial asthmatic patients [10] These observations suggest that HAT might mediate airway in ammation by PAR -2 activation In addition to airway in ammation, hypersecretion of airway...

Ngày tải lên: 30/03/2014, 11:20

... binding residues (W9AMY2, H92AMY2, T94AMY2, A9 5AMY2, Y130AMY2, A1 45AMY2, F180AMY2, K182AMY2, W206AMY2, S208AMY2, Y211AMY2, H288AMY2, Q294AMY2, M296AMY2 and Q35TAA, H 122 TAA, R204TAA, K209TAA, H210TAA, ... superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 and Y82TAA are at subsite )1 as are H92AMY2 and H 122 TAA; M52AMY2 ... acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and (i.e domain B) from AMY2 (in green) and TAA (in black)...

Ngày tải lên: 31/03/2014, 08:20

... that the woman is disabled Shakespeare makes the point that there is an assumption here that any sexual contact is better than no sexual contact (Shakespeare 1996) A further disturbing aspect of ... that the disabled person was somehow less than the surrogate herself It was considered reasonable by the surrogate that a fee (£60) was charged, partly because it is after all a 'business' transaction, ... refer to an attribute that is discrediting To an extent this derives from traditional cultural and media assumptions about physical beauty and "attractiveness" Disabled people are seldom portrayed...

Ngày tải lên: 02/04/2014, 17:58

... including breast, ovarian, cervical and renal carcinoma [1 ,2] and represents an attractive therapeutic target Trastuzumab (Herceptin), a recombinant humanized monoclonal antibody binding Her2, ... malignant transformation of cells at the site of injection a kinase deficient Her2 DNA sequence (E 2A) containing a mutation in codon 753 to convert a lysine (AAA) to an alanine (GCA) residue in ... models have implicated vaccine induced antibodies as a major factor in conferring protection against transplantable and spontaneous Her2 expressing tumors [44-46] Mainly non-professional APC in PBMC...

Ngày tải lên: 18/06/2014, 16:20

... used in the study: caspase-3: 5'gggcctgaaataccaagtca-3' and 5'-aaatgaccccttcatcacca-3'; Dsip1: 5'-ggtggccctagacaacaaga-3' and 5'-tcaagcagctcacgaatctg-3'; CIDE-B: 5' ctggaactcagctcctccac-3' and ... E1B-interacting protein Baculoviral IAP repeat-containing BCL2/adenovirus E1B-interacting protein Apoptosis inhibitor TSC 22 domain family Cell-death inducing DNA fragmentation factor CASP2 and ... domain family TNF receptor superfamily member 1 2a Activating transcription factor B-cell leukemia/lymphoma 10 BH3 interacting domain death agonist Defender against cell death MAP kinase interacting...

Ngày tải lên: 19/06/2014, 22:20

... 20 09, 38: 121 8- 122 7 Della Rocca J, Lin WB: Nanoscale Metal-Organic Frameworks: Magnetic Resonance Imaging Contrast Agents and Beyond Eur J Inorg Chem 20 10, 3 725 -3734 Gianferrara T, Bratsos I, Alessio ... Siddiqui MA, Ahmad J, Musarrat J, Al-Khedhairy AA, AlSalhi MS, Alrokayan SA: Oxidative stress mediated apoptosis induced by nickel ferrite nanoparticles in cultured A5 49 cells Toxicology 20 11, 28 3:101-108 ... nanoparticles in human lung epithelial A5 49 cells Toxicol in Vitro 20 11, 25 :930-936 26 Ahamed M, Siddiqui MA, Akhtar MJ, Ahmad I, Pant AB, Alhadlaq HA: Genotoxic potential of copper oxide nanoparticles...

Ngày tải lên: 21/06/2014, 02:20

... Chem 1996; 27 1 :29 347 29 3 52 Eng LF, Ghirnikar RS GFAP and astrogliosis Brain Pathol 1994; 4 :22 9 23 7 21 22 23 24 Fawcett JW, Asher RA The glial scar and central nervous system repair Brain Res Bull ... Marshall CJ Activation of the MAP kinase pathway by the protein kinase raf Cell 19 92; 71:335–3 42 Valverde AM, Teruel T, Lorenzo M, Benito M Involvement of Raf-1 kinase and protein kinase Cf in ... spontaneous conformational changes, resulting in ligand-independent activation [20 ] In addition to Gs activation and consequent cAMP production, the β2AR can activate Gi proteins, a property that...

Ngày tải lên: 08/08/2014, 17:20

... respiration Water-use efficiency of a native Florida scrub oak-palmetto community containing two dominant oak species (Q myrtifolia and Q geminata) was increased 34% in elevated CO and leaf respiration ... field chambers This initial stimulation of growth in elevated CO was associated with increased leaf area, and increased leaf area provides greater growth potential and subsequent leaf area production, ... efficiency increased in Q petraea without a significant increase in photosynthesis (Picon et al, 1996b) The initial increase in photosynthetic rate in Q roburwas not sustained, but Q prinus seedlings always...

Ngày tải lên: 08/08/2014, 18:21

... 2. 05 CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.9 92 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.9 92 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Mice were injected ... 0.997 2. 05 GGCAAATTCAACGGCACA GTTAGTGGGGTCTCGCTCCTG Collagen IA 0.997 2. 10 TGACTGGAAGAGCGGAGAGTACT CCTTGATGGCGTCCAGGTT Collagen II 0.9 92 2.15 TTCCACTTCAGCTATGGCGA GACGTTAGCGGTGTTGGGAG Collagen ... translated into an actual production of aggrecan, 35SO 42- incorporation into patellar and tibial cartilage was assessed The cartilage of the patella and the tibia was isolated 3, 7, and 21 days after...

Ngày tải lên: 09/08/2014, 10:21

... PAR -2 antagonists in the treatment of OA, not only as an anticatabolic and anti-inflammatory but as an analgesic as well Indeed, the proanalgesic properties of PAR -2 have shown that its activation ... participated in acquisition of data, analysis and interpretation of data, statistical analysis, and manuscript preparation JMP and JPP participated in study design, analysis and interpretation of data, and ... activation teinase-activated receptor (PAR -2) activation Immunostaining data of osteoarthritic cartilage untreated (n = 12) and treated with IL-1β (n = 12) , PAR -2- activating peptide (PAR -2- AP) μM (n...

Ngày tải lên: 09/08/2014, 10:22

... cell surface J Biol Chem 20 05; 28 0 :22 20 22 28 75 Ivanov AI, Nusrat A, Parkos CA Endocytosis of epithelial apical junctional proteins by a clathrin-mediated pathway into a unique storage compartment ... expressing claudin 1, 2, or indicate that claudin interacts with claudin and claudin on adjacent cells; however, claudin and claudin not interact (46) Finally, gene deletion studies have demonstrated ... superoxide dismutase and catalase Invest Ophthalmol Vis Sci 1993; 34 :20 18 20 22 54 Kuriyama H, Waki M, Nakagawa M, Tsuda M Involvement of oxygen free radicals in experimental retinal ischemia and the selective...

Ngày tải lên: 09/08/2014, 20:22

... can be as high as 100% (Table 2) For calculating bioavailability fraction (F), aqueous humor AUC can be determined by intracameral injection (27 ,46) or topical instillation with plugged drainage ... conjunctival uptake and drainage via the nasolacrimal duct Both lead to systemic absorption by way of conjunctival blood vessels in the former case or via the nasal mucosa and gastrointestinal tract in ... can also a ect drainage and noncorneal absorption A comparison of attributes between rabbit and human eyes has been presented in Table In vivo evaluations in humans and rabbits by Edelhauser and...

Ngày tải lên: 10/08/2014, 00:20

... Moskowitz MA, Bonventre JV, Alessandrini A: Intravenous administration of MEK inhibitor U0 126 affords brain protection against forebrain ischemia and focal cerebral ischemia Proc Natl Acad Sci USA 20 01, ... microRNA -22 1 and 22 2 in PC 12 cells FEBS J 20 09, 27 6: 326 9- 327 6 17 Xue L, Murray JH, Tolkovsky AM: The Ras/phosphatidylinositol 3-kinase and Ras/ERK pathways function as independent survival modules ... a return to baseline during the pro-death phase (fig 3) Pharmacological blockade was again used to ascertain that these temporally correlated biochemical changes are causally linked to MEK1/2...

Ngày tải lên: 10/08/2014, 05:21

... didanosine/indinavir (n = 5), zidovudine/didanosine/ indinavir (n = 1), stavudine/didanosine/indinavir/ nevirapine (n = 1), stavudine/didanosine/nelfinavir (n = 3), stavudine/lamivudine/nelfinavir ... Iowa, AI 27 661, AI 58740), N Hanks and S Souza (University of Hawaii, AI 328 53), B Lambert and M Saag (University of Alabama at Birmingham, AI 694 52) , M Witt and R.Lopez (Harbor-UCLA Medical ... counts and maintained these levels, in comparison to those newly receiving IL -2 whose CD4 counts increased and attained Page of Continue IL -2 Start IL -2 A3 28 week 12 week 53 27 53 27 Previous IL -2, ...

Ngày tải lên: 10/08/2014, 05:21