909 april 5 1994 a possibility to broaden the unamir mandate

A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV)   induced reactive oxygen species (ROS) production in u937 cells

A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV) induced reactive oxygen species (ROS) production in u937 cells

... modulate signal transduction pathways such as the MAP kinase signaling pathways, JAK/STAT signaling pathways, PI3K/Akt pathway and cAMP/cGMP signaling pathway (Holme and Pervaiz, 2007; Pervaiz and Holme, ... pro-inflammatory and anti-inflammatory cytokines (Kawahara et al., 2007) ROS generated via NOX serve as secondary signaling molecules involved in signal transduction pathways that lead to the production ... promoted the activity of NOX5 The active c-Abl was also shown to translocate and interact with NOX5 at the membrane (El Jamali et al., 2008) The physiological relevance of the c-Abl-NOX5 interaction...

Ngày tải lên: 26/09/2015, 10:44

110 528 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...

Ngày tải lên: 24/09/2012, 17:19

88 986 8
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5 -CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... pyk3 (5 -GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5 -CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and ... at the TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5 -TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5 -GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... (19 85) Morphological study of the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...

Ngày tải lên: 07/03/2014, 12:20

10 452 0
Money and happiness a guide to living the good life

Money and happiness a guide to living the good life

... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial ... So that weekend I went to Saks locally and told them that I was in New York, had bought all this makeup, came home, and my husband had a fit They took it all back That’s so me—there was no way ... importantly, understand how to manage it so it maximizes their happiness They have defined the good life” in a way that’s authentic to them, and use money to realize a personal vision Back in the 1990s,...

Ngày tải lên: 12/03/2014, 14:51

258 358 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a ... interface which is a gateway to information on adaptation practices worldwide – the Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations,...

Ngày tải lên: 16/03/2014, 14:21

49 557 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

... manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area and appropriateness ... seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts are minimised ... also It is recommended that this guide is used to help select a suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager...

Ngày tải lên: 16/03/2014, 19:20

5 527 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... and  accounts  for  75%   to 85%   of  the total  yearly  rainfall,  whereas  the dry  season  lasts  up  to 6  months,  from  February  to July  and occupies only  15 25%  of the total rainfall.   ... objectives and requirements of related factors,  as well as the alternatives that have been used  in  the study  area.  From  that  it  suggests  the measures to solve the problems and apply the MCA approach for selecting the most suitable  ... The responsibility of the scientists is to screen  among these alternatives the feasible measures  based  on  applicability  and  suitability  for  the local conditions.   2.4. Evaluation criteria   After the problem and its constraints have ...

Ngày tải lên: 22/03/2014, 12:20

13 488 0
hacking vim a cookbook to get the most out of the latest vim editor

hacking vim a cookbook to get the most out of the latest vim editor

... Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali Chittar Shantanu Zagade About the ... 1991 as a clone of the Unix editor vi for the Amiga platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor ... menu In the case of a 'toolbar menu', you will be able to add items to it by using a menu-path that starts with the name ToolBar To add an item to the toolbar that gives access for executing the...

Ngày tải lên: 01/06/2014, 10:43

224 942 0
báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

... Tool, and UNITAID as provided by the Clinton Health Access Initiative [11-14] Antiretroviral transactional data was systematically cleaned and validated using a market intelligence database described ... Cambridge, MA, USA Page of Authors’ contributions BW designed and coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ED performed data ... performed data cleaning and data analysis SM contributed to data analysis, writing of the manuscript, and editing for important content All authors read and approved the final version of the manuscript...

Ngày tải lên: 20/06/2014, 08:20

9 283 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

... (interpersonal care) because they formed a more clinical and statistical cohesive set together rather than existing as separate scales For the same reasons, three domains (physical comfort, technical aspects ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality ... similar mean scores and standard deviations implying that they contribute equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales...

Ngày tải lên: 20/06/2014, 15:20

8 493 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

... years younger than patients without distant metastases (54 years) [p = 0.02] in the IDC group For all invasive carcinomas, the average age of patients with distant metastases was 46 years compared ... study, there was a significant association of age, grade, lymph node spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an ... expression was significantly associated with grade, lymph node spread, oestrogen receptor status and histological subtype for all invasive carcinomas These are factors that are also easily assessed...

Ngày tải lên: 09/08/2014, 01:24

9 424 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

... 82 :58 1-629 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Academy of Management Journal 1991, 34 :55 5 -59 0 Damanpour F: Organizational complexity and ... organizations that are able to acquire, assess, adapt, and apply research and those that have fewer supports to so Further, the distinctions that the tool makes in relation to these four areas are ... been available Our observation from the focus groups was that the more useful aspect of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual...

Ngày tải lên: 11/08/2014, 05:21

9 506 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

... 82 :58 1-629 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Academy of Management Journal 1991, 34 :55 5 -59 0 Damanpour F: Organizational complexity and ... organizations that are able to acquire, assess, adapt, and apply research and those that have fewer supports to so Further, the distinctions that the tool makes in relation to these four areas are ... been available Our observation from the focus groups was that the more useful aspect of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual...

Ngày tải lên: 11/08/2014, 16:20

9 412 0
Báo cáo y học: " Mimicking microbial ‘education’ of the immune system: a strategy to revert the epidemic trend of atopy and allergic asthma?" ppt

Báo cáo y học: " Mimicking microbial ‘education’ of the immune system: a strategy to revert the epidemic trend of atopy and allergic asthma?" ppt

... Immunoprophylaxis of atopy: light at the end of the tunnel? Immunol Today 1994, 15: 484–489 Authors’ affiliations: DASRS, RMAS, Laboratory of Immunology and Allergy, Pomezia (Rome), Italy (Paolo Maria Matricardi), ... extracts ‘Immunoeducation’: a novel strategy or an utopian goal? Bacteria or bacterial products are already being tested against allergic diseases Encouraging preliminary data are coming from animal ... ‘unhygienic’ areas inhale and ingest a different kind, variety and amount of bacteria compared with children of farmers and anthroposophic families, who have access to natural soil and eat only biologically...

Ngày tải lên: 12/08/2014, 18:20

4 335 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps

Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps

... Hopkin JM: Atopy and asthma: genetic variants of IL-4 and IL-13 signalling Immunol Today 2000, 21:60–64 1 05 Takabayashi A, Ihara K, Sasaki Y, Suzuki Y, Nishima S, Izuhara K, Hamasaki N, Hara T: Childhood ... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... list of candidate genes investigated with regard to traits associated with asthma and atopy The most investigated candidate location for atopy and asthma susceptibility loci has been the 5q31–33...

Ngày tải lên: 12/08/2014, 18:20

11 491 0
Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt

Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt

... data analysis and co-wrote the first draft of the manuscript AD participated in the design of the study, derived one of the base deficit formulae and advised on data analysis JA performed data ... since the publication of recent safety data [20] Albumin-based fluids can propagate an acidosis by two mechanisms: they increase plasma albumin concentration, and most contain an abundant source ... group as a whole (mean pH 7.31, BDtot -7.4) The unmeasured anionrelated base deficit was greater than the total base deficit; this was predominantly due to the alkalinising effect of hypoalbuminaemia...

Ngày tải lên: 12/08/2014, 22:22

7 326 0
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx

Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx

... (5' -cacacacaaggctgacttccct-3') and NI2R (5' gccactccccagtccgccc-3') The primers used to detect the ampicillin resistant gene are AmpF (5' -gataacactgcggccaactt-3') and AmpR (5' -ttgccgggaagctagagtaa-3') ... these factors would similarly affect both the calibration cultures and the sample, allowing a valid, direct comparison of the growth curves To obtain a more precise estimate, an idealised mathematical ... of the peak count reached by the culture (CT) The data was plotted onto a graph (Figure 4) The data in this table are not directly comparable to that shown in figure because the total numbers...

Ngày tải lên: 13/08/2014, 09:20

10 279 0
w