9 embryonic stem cells using nuclear transfer

Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

Ngày tải lên : 31/10/2012, 16:57
... 2000;18(4): 399 -404 Richards M, Fong CY, Tan S, Chan WK, Bongso A An efficient and safe xeno-free cryopreservation method for the storage of human embryonic stem cells Stem Cells 2004;22(5):7 79- 89 10 ... Marshall VS, Jones JM Embryonic stem cell lines derived from human blastocysts Science 199 8;282(5 391 ):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from ... Blasco MA Telomere length dynamics and chromosomal instability in cells derived from telomerase null mice J Cell Biol 199 9;144: 5 89- 601 Ready T NIH posts online ES-cell registry Nat Med 2001;7(12):1262...
  • 6
  • 477
  • 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Ngày tải lên : 07/03/2014, 12:20
... regulation Cell 100, 499 –502 Levings PP & Bungert J (2002) The human beta-globin locus control region Eur J Biochem 2 69, 15 89 1 599 Stamatoyannopoulos GNAW, Mjerus PW & Varmus H ( 199 4) The Molecular ... is potentiated in hematopoietic progenitor cells prior to their transcriptional activation Blood 102, 398 9– 399 7 12 Delassus S, Titley I & Enver T ( 199 9) Functional and molecular analysis of hematopoietic ... differentiation of mouse embryonic stem cells to hematopoietic cells on an OP9 stromal cell monolayer Methods Enzymol 365, 72–83 21 Strahl BD, Ohba R, Cook RG & Allis CD ( 199 9) Methylation of histone...
  • 10
  • 422
  • 0
Báo cáo khoa học: Epigenetics: the study of embryonic stem cells by restriction landmark genomic scanning pptx

Báo cáo khoa học: Epigenetics: the study of embryonic stem cells by restriction landmark genomic scanning pptx

Ngày tải lên : 23/03/2014, 07:20
... study of embryonic stem cells TE N Hattori and K Shiota ICM PGC TS cells Placental cells 77 ES cells 49 EG cells Embryonic cells Fig Epigenetic distances between ES cells and other stem cells derived ... methylation specific to stem, germ and somatic cells in mice Genes Cells 7, 96 1 96 9 10 Nagy A, Gocza E, Diaz EM, Prideaux VR, Ivanyi E, Markkula M & Rossant J ( 199 0) Embryonic stem cells alone are able ... Cell 69, 91 5 92 6 30 Lei H, Oh SP, Okano M, Juttermann R, Goss KA, Jaenisch R & Li E ( 199 6) De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells Development 122, 3 195 –3205...
  • 7
  • 439
  • 0
embryonic stem cells, methods and protocols - kursad turksen

embryonic stem cells, methods and protocols - kursad turksen

Ngày tải lên : 08/04/2014, 12:51
... ( 199 8) Formation of pluripotent stem cells in the mammalian embryo depend on the POU transcription factor Oct4 Cell 95 , 3 793 91 12 Smith, A G ( 199 1) Culture and differentiation of embryonic stem ... Huebner, R J ( 195 9) Studies on mouse polyoma virus infection J Exp Med 1 09, 3 793 91 18 Darer, M M., Dougherty, C., and Goldsborough, M D ( 199 6) The mouse YES system: a novel reagent system for the ... 0- 896 03-881-5 (alk paper) Embryonic Stem Cells Laboratory manuals I Turksen, Kursad II Series QH440.5 E43 2002 612'.0181 dc21 20010264 59 Preface It is fair to say that embryonic stem (ES) cells...
  • 516
  • 553
  • 0
differentiation of embryonic stem cells

differentiation of embryonic stem cells

Ngày tải lên : 11/04/2014, 00:32
... from Murine Embryonic Stem Cells 11 Development of Lymphoid Lineages Embryonic Stem Cells In Vitro from 12 Probing Dendritic Cell Function by Guiding the Differentiation of Embryonic Stem Cells 13 ... AND SHIN-ICHI HAYASHI 98 v vi TABLE OF CONTENTS Development of Hematopoietic Repopulating Cells from Embryonic Stem Cells The In Vitro Differentiation of Mouse Embryonic Stem Cells into Neutrophils ... Culture of Embryonic Germ Cells MARIA P DE MIGUEL AND PETER J DONOVAN 353 Section III Gene Discovery by Manipulation of Mouse Embryonic Stem Cells 26 Gene Trap Mutagenesis in Embryonic Stem Cells...
  • 574
  • 619
  • 0
báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

Ngày tải lên : 18/06/2014, 15:20
... precursors Blood 2000, 95 :95 2 -95 8 Yamashita J, Itoh H, Hirashima M, Ogawa M, Nishikawa S, Yurugi T, Naito M, Nakao K, Nishikawa S: Flk1–positive cells derived from embryonic stem cells serve as vascular ... Investigation 199 9, 103:157-158 Dan Kaufman S, Rachel Lewis L, Eric Hanson T, Robert Auerbach, Johanna Plendl, James Thomson A: Functional endothelial cells derived from rhesus monkey embryonic stem cells ... VEGF-R2-positive cells induced from undifferentiated mouse embryonic stem (ES) cells can differentiate into both VE-cadherin-positive endothelial cells (ECs) and αSMA-positive mural cells (MCs),...
  • 14
  • 450
  • 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

Ngày tải lên : 18/06/2014, 15:20
... miR-200b miR -96 miR-302b* miR-612 miR- 299 -3p miR-550-2 miR-127 miR-3 69- 3p miR-520g miR-515-5p miR-519c miR-372 miR-520d miR-526b* miR-525 miR-518b miR-520a miR-324-3p miR-29a miR-29b miR-29c miR-132 ... either hES cells or adult cells (Figure 6, panel B) For miR-106b, miR -92 , miR -93 , miR-130a and miR- 190 , the difference in their expression between EB and hES cells and between EB and adult cells were ... differentiated human embryonic stem cells Stem Cells Dev 2007, 16(6):1003-1016 Page 15 of 17 (page number not for citation purposes) Journal of Translational Medicine 20 09, 7:20 18 19 20 21 22 23 24...
  • 17
  • 593
  • 0
báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

Ngày tải lên : 18/06/2014, 15:20
... AGCTTAGTGATACTTGTGGGCCAG 1 29 144 196 196 2 19 216 1 59 104 282 282 304 370 302 59 59 59 59 59 59 59 59 60 60 59 59 59 Page of 10 (page number not for citation purposes) Journal of Translational Medicine 20 09, 7:27 ... murine embryonic stem cells Biol Reprod 199 7, 57(3):561-8 Bonde S, Zavazava N: Immunogenicity and engraftment of mouse embryonic stem cells in allogeneic recipients Stem Cells 2006, 24(10):2 192 -201 ... immune rejection than adult cells Stem Cells 2006, 24(2):221 -9 Koch CA, Geraldes P, Platt JL: Immunosuppression by embryonic stem cells Stem Cells 2008, 26(1): 89- 98 Fabricius D, Bonde S, Zavazava...
  • 10
  • 409
  • 0
EMBRYONIC STEM CELLS – DIFFERENTIATION AND PLURIPOTENT ALTERNATIVES doc

EMBRYONIC STEM CELLS – DIFFERENTIATION AND PLURIPOTENT ALTERNATIVES doc

Ngày tải lên : 27/06/2014, 19:20
... stem cells These include very small embryonic/ epiblast like stem cells, multipotent dental stem cells, pluripotent stem cells from testis and amniotic fluid stem cells In the book Embryonic Stem ... human embryonic stem cells J Cell Biochem, 2010 1 09( 1): p 93 -102 [130] Boyer, L.A., et al., Core transcriptional regulatory circuitry in human embryonic stem cells Cell, 2005 122(6): p 94 7-56 ... 2004 4 29( 699 4): p 90 0-3 [227] Tsumura, A., et al., Maintenance of self-renewal ability of mouse embryonic stem cells in the absence of DNA methyltransferases Dnmt1, Dnmt3a and Dnmt3b Genes Cells, ...
  • 518
  • 390
  • 1
EMBRYONIC STEM CELLS – DIFFERENTIATION AND PLURIPOTENT ALTERNATIVES pdf

EMBRYONIC STEM CELLS – DIFFERENTIATION AND PLURIPOTENT ALTERNATIVES pdf

Ngày tải lên : 28/06/2014, 04:20
... stem cells These include very small embryonic/ epiblast like stem cells, multipotent dental stem cells, pluripotent stem cells from testis and amniotic fluid stem cells In the book Embryonic Stem ... human embryonic stem cells J Cell Biochem, 2010 1 09( 1): p 93 -102 [130] Boyer, L.A., et al., Core transcriptional regulatory circuitry in human embryonic stem cells Cell, 2005 122(6): p 94 7-56 ... 2004 4 29( 699 4): p 90 0-3 [227] Tsumura, A., et al., Maintenance of self-renewal ability of mouse embryonic stem cells in the absence of DNA methyltransferases Dnmt1, Dnmt3a and Dnmt3b Genes Cells, ...
  • 518
  • 442
  • 0
EMBRYONIC STEM CELLS –  BASIC BIOLOGY TO BIOENGINEERING   doc

EMBRYONIC STEM CELLS –  BASIC BIOLOGY TO BIOENGINEERING   doc

Ngày tải lên : 28/06/2014, 05:20
... Applications of Embryonic Stem Cells in Research and Development 191 Chapter 11 Methods to Generate Chimeric Mice from Embryonic Stem Cells 193 Kun-Hsiung Lee Chapter 12 Embryonic Stem Cells in Toxicological ... (2008) Neural Differentiation of Human Embryonic Stem Cells, In: Neural Stem Cells : Methods and Protocols, Weiner, L.P., pp ( 19- 30), Humana Press, 97 8-1-588 29- 846-1, Totowa, NJ, USA Evans, M.J., ... approach Cloning Stem Cells, Vol 11, No 1, (Mar), pp ( 39- 50) Li, M., Pevny, L., Lovell-Badge, R., & Smith, A ( 199 8) Generation of purified neural precursors from embryonic stem cells by lineage...
  • 490
  • 420
  • 0
Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf

Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf

Ngày tải lên : 07/08/2014, 18:21
... pluripotent embryonic stem cells from reprogrammed adult mouse somatic cell nuclei Curr Biol 2000, 10, 98 9 -99 2 48 Nicholas J, Chambers I, Smith A Derivation of germline competent embryonic stem cells ... Exp Cell Res 199 4, 215, 237-2 39 49 Nichols J, Evans EP, Smith AG Establishment of germlinecompetent embryonic stem (ES) cells using differentiationinhibiting activity Development 199 0, 110, 1341-1348 ... generated from adult somatic cells by nuclear transfer Science 2001, 292 , 740-743 80 Wiles MV Embryonic stem cell differentiation in vitro Methods Enzymol 199 3, 225, 90 0 -91 8 81 Wilmut I, Schnieke...
  • 10
  • 403
  • 0
Báo cáo khoa học: " Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced oxidative stress" pdf

Báo cáo khoa học: " Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced oxidative stress" pdf

Ngày tải lên : 07/08/2014, 20:23
... molecular basis of pluripotency in mouse embryonic stem cells Cloning Stem Cells 2004, 6, 386- 391 17 Cobb MH, Goldsmith EJ How MAP kinases are regulated J Biol Chem 199 5, 270, 14843-14846 18 Cochrane ... of human prostate carcinoma cells J Natl Cancer Inst 199 7, 89, 40-48 53 Sherr CJ, Roberts JM Inhibitors of mammalian G1 cyclin-dependent kinases Genes Dev 199 5, 9, 11 49- 1163 54 Sigaud S, Evelson ... Embryonic stem cell models of development Anat Rec 199 9, 257, 32-41 48 Ohkawa H, Ohishi N, Yagi K Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction Anal Biochem 197 9,...
  • 10
  • 263
  • 0
The signals of FGFs on the neurogenesis of embryonic stem cells ppsx

The signals of FGFs on the neurogenesis of embryonic stem cells ppsx

Ngày tải lên : 10/08/2014, 05:21
... Development 2007, 134:2 895 - 290 2 Burdon T, Stracey C, Chambers I, Nichols J, Smith A: Suppression of SHP-2 and ERK signalling promotes self-renewal of mouse embryonic stem cells Dev Biol 199 9, 210:30-43 ... FGF-1 Biochemistry 199 9, 38 :92 64 -92 72 Wojtaszek PA, Heasley LE, Siriwardana G, Berl T: Dominant-negative c-Jun NH2-terminal kinase sensitizes renal inner medullary collecting duct cells to hypertonicity-induced ... Neuron 199 9, 22:667-676 32 Pages G, Guerin S, Grall D, Bonino F, Smith A, Anjuere F, Auberger P, Pouyssegur J: Defective thymocyte maturation in p44 MAP kinase (Erk 1) knockout mice Science 199 9,...
  • 11
  • 194
  • 0
Báo cáo y học: "Identification of a truncated form of methionine sulfoxide reductase a expressed in mouse embryonic stem cells" pps

Báo cáo y học: "Identification of a truncated form of methionine sulfoxide reductase a expressed in mouse embryonic stem cells" pps

Ngày tải lên : 10/08/2014, 05:21
... oxygen depletion/reoxygenation conditions in mouse embryonic stem cells Methods Mouse embryonic stem cell culture The mouse embryonic stem (MES) cells (CCE-24) were routinely grown on 0.1% gelatin-coated ... Genbank (Genbank ID: BG97 095 3.1) with the same intron splicing pattern as the truncated form of MsrA cloned from embryonic stem cells, indicating this isoform might not be stem cell specific The ... anoxic treatment of mouse embryonic stem cells was performed by incubating the cells in an anaerobic chamber (Sheldon Manufacturing Inc., Cornelius, OR) supplied with 90 % nitrogen gas, 5% hydrogen...
  • 10
  • 309
  • 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

Ngày tải lên : 11/08/2014, 12:21
... embryonic stem cells Cell Stem Cell 2011, 8:200-213 76 Kriaucionis S, Heintz N: The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain Science 20 09, 324 :92 9 -93 0 ... Plath K, Lowry WE: Induced pluripotent stem cells and embryonic stem cells are distinguished by gene expression signatures Cell Stem Cell 20 09, 5:111-123 93 Chin MH, Pellegrini M, Plath K, Lowry ... Plath K, Lowry WE: Molecular analyses of human induced pluripotent stem cells and embryonic stem cells Cell Stem Cell 2010, 7:263-2 69 94 Deng J, Shoemaker R, Xie B, Gore A, LeProust EM, Antosiewicz-Bourget...
  • 13
  • 338
  • 0
báo cáo khoa học: " Embryonic stem cells in scaffold-free threedimensional cell culture: osteogenic differentiation and bone generation" ppt

báo cáo khoa học: " Embryonic stem cells in scaffold-free threedimensional cell culture: osteogenic differentiation and bone generation" ppt

Ngày tải lên : 11/08/2014, 20:21
... of osteogenic cells derived from human embryonic stem cells Tissue Eng 2004, 10:1518-1525 17 Chaudhry GR, Yao D, Smith A, Hussain A: Osteogenic Cells Derived From Embryonic Stem Cells Produced ... directing the differentiation of stem cells into the osteogenic lineage in vitro J Bone Miner Res 2004, 19: 13 79- 1 394 Page of 38 Trounson A: Human embryonic stem cells: mother of all cell and tissue ... 199 2, 186:107-124 35 Burt RK, Verda L, Kim DA, Oyama Y, Luo K, Link C: Embryonic stem cells as an alternate marrow donor source: engraftment without graft-versushost disease J Exp Med 2004, 199 : 895 -90 4...
  • 6
  • 257
  • 0
báo cáo khoa học:" Induction of osteogenic markers in differentially treated cultures of embryonic stem cells" ppt

báo cáo khoa học:" Induction of osteogenic markers in differentially treated cultures of embryonic stem cells" ppt

Ngày tải lên : 12/08/2014, 01:22
... autologous cells as well as allogenic and xenogenic cells [13-16] There are some reports that use totipotential embryonic stem cells in tissue engineering of bone [17,18] Embryonic stem cells (ESCs) ... osteogenic cells derived from human embryonic stem cells Tissue Eng 2004, 10 (91 0):1518-1525 Evans MJ, Kaufman MH: Establishment in culture of pluripotential cells from mouse embryos Nature 198 1, 292 (58 19) :154-156 ... murine embryonic stem cells Tissue Eng 2001, 7(1): 89- 99 Zhang R, Ducy P, Karsenty G: 1,25-dihydroxyvitamin D3 inhibits Osteocalcin expression in mouse through an indirect mechanism J Biol Chem 199 7,...
  • 7
  • 397
  • 0
Báo cáo y học: "Identification and isolation of embryonic stem cells in reproductive endocrinology: theoretical protocols for conservation of human embryos derived from in vitro fertilization" ppsx

Báo cáo y học: "Identification and isolation of embryonic stem cells in reproductive endocrinology: theoretical protocols for conservation of human embryos derived from in vitro fertilization" ppsx

Ngày tải lên : 13/08/2014, 23:20
... for pluripotent stem cells Nature 2001, 414 :92 -97 23 24 25 26 Doerflinger RM: The ethics of funding embryonic stem cell research: a Catholic viewpoint Kennedy Inst Ethics J 199 9, 9: 137-150 Coalition ... Engl J Med 199 2, 327 :90 5 -90 9 Munne S, Lee A, Rosenwaks Z, Grifo J, Cohen J: Diagnosis of major chromosome aneuploidies in human preimplantation embryos Hum Reprod 199 3, 8:2185-2 191 Baart EB, ... Swiergiel JJ, Marshall VS, Jones JM: Embryonic stem cell lines derived from human blastocysts Science 199 8, 282:1145-1147 Fischbach GD, Fischbach RL: Stem cells: science, policy, and ethics J...
  • 8
  • 368
  • 0