9 formation of a template for ecg analysis identification of fiducial points

... 17(1):43–75 Masaki Murata, Kiyotaka Uchimoto, Qing Ma, Toshiyuki Kanamaru, and Hitoshi Isahara 2005 Analysis of machine translation systems’ errors in tense, aspect, and modality In Proceedings of PACLIC ... identify statistical machine translation errors In Proceedings of EAMT, pages 52–57, Saint Rapha¨ l, France e 61 Mary Flanagan 1994 Error classification for MT evaluation In Proceedings of AMTA, pages ... Philadelphia, Pennsylvania, USA Maja Popovi´ , Adri` de Gisper, Deepa Gupta, Patrik c a Lambert, Hermann Ney, Jos´ Mari˜ o, and Rafael e n Banchs 2006 Morpho-syntactic information for automatic...

Ngày tải lên: 07/03/2014, 22:20

... chemical compound names, name normalization is a possible approach Rules can be set up to transform syntactic as well as morphological variations of names into a normalized name form Basic transformations ... constraints over a collection of variables Each of the variables has a domain, which is the set of possible values the variable can take For the reasons named above, we are working with graph variables ... CompLife, pages 107–118 Kirill Degtyarenko, Paula de Matos, Marcus Ennis, Janna Hastings, Martin Zbinden, Alan McNaught, Rafael Alc´ ntara, Michael Darsow, Micka¨ l Guedj, a e and Michael Ashburner...

Ngày tải lên: 08/03/2014, 01:20

... variables For example, gene expression data are automatically matched to the corresponding mRNA variables, and protein measurements are matched to the corresponding protein variables As part of ... provided as is and no guarantee or warranty is given that the information is fit for any particular purpose The user thereof uses the information at its sole risk and liability The graphical capabilities ... the paper RS conceived and supervised the study and co-wrote the paper Additional data files The following additional data are available with the online version of this paper Additional data file...

Ngày tải lên: 14/08/2014, 08:20

... the quantification and analysis of TCP/IP inter-flow field behavior based on a database of million packet headers captured from real traffic The details on the behaviour of all TCP/IP header fields ... work and discussions with Mr Sukanta Kumar Hazra and Mr Wang Haiguang Many others have contributed to making the author’s candidature at the Institute for Infocomm Research a satisfying and enlightening ... applicable to Channel B, we know from Eq (3.4) as nA → ∞, jA → ∞ that P ( LA = l A ) = where A l A( n A − l ) n A →∞ ( ), P A0 = 1, A 1 = 0, , A lA = 0, A lA −1 = P ( A0 = 1) (3.8) We assume that...

Ngày tải lên: 16/09/2015, 12:35

... imposition of formal or informal sanctions on the actor in case of malperformance or, for that matter, of rewards in case of adequate performance This is what I would call narrow accountability.4 ... public authority, are subject to public accountability at all This is basically a mapping exercise – for example: what are the accountabilities, formal and informal, of a particular European agency? ... great variety of administrative agents, but gradually they have acquired a legitimacy of their own and they can act as independent accountability forums Most forms of professional accountability...

Ngày tải lên: 11/12/2016, 11:11

Ngày tải lên: 09/12/2013, 18:15

... we have presented a database for the analysis of spontaneous emotions The database contains physiological signals of 32 participants (and frontal face video of 22 participants), where each participant ... this database has the highest number of participants in publicly available databases for analysis of spontaneous emotions from http://www.eecs.qmul.ac.uk/mmv/datasets/deap/ TABLE Database content ... dominance and familiarity For 22 participants, frontal face video was also recorded This paper aims at introducing this publicly available2 database The database contains all recorded signal data, frontal...

Ngày tải lên: 07/03/2014, 14:20

... Krystyna Szyku a, Axente Stoica, Dan Savastru, Marina Tautan, Carla Bernadete Madureira Cruz, Rafael Silva de Barros, Janvier Fotsing, Emmanuel Tonye, Bernard Essimbi Zobo, Narcisse Talla Tankam, ... Chapter Mathematical Analysis in Cartography by Means of Computer Algebra System Shao-Feng Bian and Hou-Pu Li Chapter Web Map Tile Services for Spatial Data Infrastructures: Management and Optimization ... Landscape and Cartography: Studies on the Cultural Heritage at a Territorial Scale 277 Pilar Chias and Tomas Abad Chapter 13 Imaging the Past: Cartography and Multicultural Realities of Croatian...

Ngày tải lên: 28/06/2014, 10:20

... phối cách tạo quan hệ với khách hàng để tạo lợi nhuận Startup phải quay trở lại bước Customer Discovery để tìm hướng Ảnh Canvas, trích từ Business Model Generation Trong Canvas trên, nhiệm vụ ... bao gồm VP, CR, CH, CS, Revenue (R$) Bước Customer Discovery nhằm điền vào Value Proposition (VP) Customer Segment (CS) Bước Customer Validation nhằm xác định Sale channel (CH) Customer Relationship ... thuyết Giai đoạn đầu Startup trọng tìm hiểu “vì sao” tìm hiểu hành vi, thái độ khách hàng diện rộng Vì phương án vấn trực tiếp sử dụng đầu tiên, sau áp dụng thêm vấn từ xa qua bảng hỏi điện tử A, Xác...

Ngày tải lên: 31/07/2014, 16:34

... clinical diagnosis Arch Dermatol 1995, 131:298-304 Saida T, Yoshida N, Ikegawa S, Ishihara K, Nakajima T: Clinical guidelines for the early detection of plantar malignant melanoma J Am Acad Dermatol ... videomicroscopic analysis Arch Dermatol 1998, 134:563-568 Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of dermoscopic patterns ... Extent and consequences of physician delay in the diagnosis of acral melanoma Melanoma Res 1998, 8:181-186 Dalmau J, Abellaneda C, Puig S, Zaballos P, Malvehy J: Acral Melanoma Simulating Warts:...

Ngày tải lên: 10/08/2014, 21:23

... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular ... (suspended biomass) to form aerobic granular sludge for all the experiments was obtained from an aerobic basin of a municipal wastewater treatment plant (Tokyo, Japan) Table - Wastewater composition ... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8...

Ngày tải lên: 05/09/2013, 10:15

... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... exchange measurement Exchange rates of CO2 were measured with an infrared gas analysis system (Uras G; Hartmann & Braun AG, Frankfurt am Main, Germany) A whole-rosette cuvette design was used as ... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch...

Ngày tải lên: 14/02/2014, 22:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

... Improved Feature Space for Sentiment Analysis In Proceedings of the Third AAAI Internatonal Conference on Weblogs and Social Media, San Jose, CA, May AAAI Press (poster paper) A Mccallum and K Nigam ... CA Ian H Witten and Eibe Frank 1999 Data Mining: Practical Machine Learning Tools and Techniques with Java Implementations (The Morgan Kaufmann Series in Data Management Systems) Morgan Kaufmann, ... Martin and P R R White 2005 The language of evaluation : appraisal in English / J.R Martin and P.R.R White Palgrave Macmillan, Basingstoke : Justin Martineau and Tim Finin 2009 Delta TFIDF: An...

Ngày tải lên: 20/02/2014, 04:20

... demonstrate large conformational changes in the eukaryotic ribosomal translocase Nat Struct Biol 10, 379–385 Al Karadaghi S, Aevarsson A, Garber M, Zheltonosova J & Liljas A (1996) The structure of ... Karplus PA (1997) Improved R-factors for diffraction data analysis in macromolecular crystallography Nat Struct Biol 4, 269–275 Richter Dahlfors AA & Kurland CG (1990) Novel mutants of elongation ... conformation (C), and EF-G stability (D) Several mutations seem to affect more than one of these parameters; for example, EF-G conformation and stability are intimately linked to FA binding as...

Ngày tải lên: 06/03/2014, 22:21

... maturity and departure from the parental animal, the timing of the appearance and the localization of the mRNA was also in accordance with the peroxidase protein Fig 10 Kinetics of the reappearance of ... dynamics of apical and basal regeneration in Hydra vulgaris (formerly Hydra attenuata) Dev Biol 144, 78– 85 42 Leontovich, A. A., Zhang, J., Shimokawa, K., Nagase, H & Sarras, M.P Jr (2000) A novel ... (Stratagene) The vector was packaged with the Gigapack II packaging extract (Stratagene) The library contained 0.8 · 106 independent plaques and was amplified once As template for PCR the cDNA was...

Ngày tải lên: 08/03/2014, 10:20

... automated real-time sentiment analysis of this user-generated data can provide fast indications of changes in opinion, showing for example how an audience reacts to particular candidate’s statements ... Mechanical Turk (AMT) to get as varied a population of annotators as possible We designed an interface that allowed annotators to perform the annotations outside of AMT so that they could participate ... while watching a campaign event and can be displayed on a tablet or smart phone The feedback from users allows annotation of recent data as well as the ability to correct misclassifications As a future...

Ngày tải lên: 16/03/2014, 20:20

... t a n d a r d ' and E r r o r Analysis For the evaluation of Cass-SWE we use three types of texts: (i) a sample taken from a manually annotated Swedish corpus of 100,000 words with grammatical ... information as well as grammatical functions in the output A corpus, annotated syntactically, is a rich source of information which we intend to use for a number of applications, e.g information ... Proceedings of EACL '99 general description of Swedish grammar was presented Its algorithmic details were unclear, and we are unaware of any descriptions in the literature of large scale applications...

Ngày tải lên: 17/03/2014, 22:20

... bacterial two-hybrid system We also thank Mr T Kobayakawa (Nagasaki University, Nagasaki, Japan) for the technical assistance This work was supported by Grants-in-Aid for Scientific Research from ... Molecular Biochemicals (Mannheim, Germany) All other reagents were of analytical grade Plasmid construction DNA fragments carrying truncated forms of human HSP9 0a amplified by PCR and cut with BamHI ... low-molecular-mass markers, from Amersham Pharmacia Biotech (Uppsala, Sweden) Talon metal affinity resin was obtained from Clontech Laboratories Inc (Palo Alto, CA, USA) Porcine heart CS was purchased from...

Ngày tải lên: 23/03/2014, 20:22

... Annals of Mathematics, 162 (2005), 1377–1389 Formation of singularities for a transport equation with nonlocal velocity ´ ´ By Antonio Cordoba∗ , Diego Cordoba∗∗ , and Marco A Fontelos∗∗ * Abstract ... existence of singularities for the 1D analog (1.6) The system (1.4) and (1.5) with σ = has the very interesting property of being ill-posed for general initial data A linear analysis of small perturbations ... Constantin, P Lax, and A Majda, A simple one-dimensional model for the three dimensional vorticity, Comm Pure Appl Math 38 (1985), 715–724 FORMATION OF SINGULARITIES FOR A TRANSPORT EQUATION...

Ngày tải lên: 29/03/2014, 07:20