9 create an instance of a net object
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
Ngày tải lên :
25/10/2012, 09:56
... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...
- 6
- 611
- 0
DESIGNING AN END OF YEAR ENGLISH OBJECTIVE TEST FOR 1ST YEAR NON MAJOR ENGLISH STUDENTS OF THE ACADEMY OF FINANCE
Ngày tải lên :
07/09/2013, 13:19
... Communicative tests As for some authors, language tests play many important roles in life McNamara (2000:4) views that language tests, first, act as “gateways at important transitional moments ... / last / has / assistants / taken / since /./ A The assistants has taken on three more manager since last summer B The manager has taken last three more assistants since on summer C The manager ... were taken The methods of data collection and data analysis are presented afterwards Finally come the limitations of the research II.1 QUANTITATIVE STUDY Like qualitative research, quantitative...
- 44
- 985
- 1
Features of a .NET Class
Ngày tải lên :
05/10/2013, 07:20
... shorthand syntax for declaring properties that map directly onto a field and have trivial get and set methods A field is created automatically for such a property, as well as the default get and ... in a class that has these properties or events In a class with a property named P, the names get_P and set_P are reserved, and in a class with an event named E, add_E, remove_E, and raise_E are ... dynamic_cast and safe_cast This difference means that dynamic_cast is not as slow as safe_cast, since throwing an exception is a particularly expensive and time-consuming operation const_cast...
- 38
- 298
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
Ngày tải lên :
16/01/2014, 21:20
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...
- 8
- 492
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Create an interior scence a z 1
Ngày tải lên :
01/04/2014, 17:32
... material with ID = And again click on material type button and choose VRayMtl You will see the options of VRay material On the top is a color of material and small box to apply a textures and ... Rest of the materials is in the Material Library Just apply it to objects and we can set the scene lightning whoooa :) End of Part3: Texturing and materials All materials are on right places and ... make cornice Step 10: Create a radiator using boxes with small Mesh Smooth To make boxes with the same distance use Array tool Step 11: Create a heap of magazines and newspapers Just make a...
- 24
- 169
- 0
An autobiography of a story book pptx
Ngày tải lên :
22/07/2014, 03:21
... would then be able to lead a more comfortable life Perhaps I can invent cars that are operated by robots or a computer that thinks like a human My parents think highly of my ambition and are very ... understand the answer In class, I always make sure that I perform each science experiment properly When in doubt, I consult my teachers As a scientist, I would be able to invent new things for mankind ... One day a few girls entered the shop They laughed and joked among themselves They were browsing through the books and one of them picked me up She was attracted to me and bought me immediately...
- 6
- 385
- 0
An autobiography of a pen doc
Ngày tải lên :
22/07/2014, 03:21
... skins and then crawled out of the old ones We then turned into large grey, yellow and orange striped caterpillars My next stage was the pupa stage I crawled under a leaf of the plant and spun a pod ... leaf of a milkweed plant After several days we hatched into tiny black and white larvae At this stage we were called tiny caterpillars We moved about the plant and fed on its fleshy green leaves ... dark corner of the drawer hoping that one day she might use me again An autobiography of a butterfly I am a beautiful Monarch butterfly My name is Jolly My mother laid some eggs on the leaf of...
- 6
- 440
- 0
An autobiography of a dancing doll ppsx
Ngày tải lên :
22/07/2014, 03:21
... lady came to the store She looked around the place and her eyes felon me She looked at me in admiration She at once bought me I was given as a birthday present to her only daughter Pam I was ... let her friends handle me When Pam was not attending to me, one of her friends picked me up Pam was furious and tried to pull me away form her friend In the tussle they accidentally ripped my pretty ... dress Pam cried and her mother consoled her by promising to buy a new doll I was given away to the servant’s daughter, who accepted me with great delight She skillfully mended the tear in my...
- 4
- 233
- 0
Báo cáo toán học: "An extension of a criterion for unimodality" pps
Ngày tải lên :
07/08/2014, 06:22
... 1994 [4] Stanley, R.: Log-concave and unimodal sequences in algebra, combinatorics and geometry Graph theory and its applications: East and West (Jinan, 1986), 500-535, Ann New York Acad Sci., ... if a j sequence is log concave then it is unimodal [5] A sufficient condition for log concavity of a polynomial is given by the location of its zeros: if all the zeros of a polynomial are real and ... 2.2 Let ≤ a0 ≤ a1 · · · ≤ am be a sequence of real numbers and n ∈ Æ , and consider the polynomial P (x) = a0 + a1 x + a2 x2 + · · · + am xm Then the polynomial P (x + n) is unimodal with mode...
- 7
- 331
- 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa
Ngày tải lên :
28/03/2015, 09:26
... learners are able to understand the formal structures and logical meaning of the material they read with an average degree of difficulty and within general and familiar topics, but cannot understand ... and its social situation British discourse analysis was mainly influenced by M .A. K Halliday‘s functional approach to language Halliday‘s framework emphasized the social function of language and ... language (i.e., cultural and 10 ideological meanings) and lower-order forms of language that contribute to patterning the meaning In layman‘s terms reader cannot neglect the role of individual...
- 66
- 704
- 0
Give an account of a visit to a book exhibition
Ngày tải lên :
27/08/2016, 07:48
... chắn bạn lớp vui mừng Cikgu Hamid nói với có hai tiếng rưỡi để duyệt sách Chúng không đánh l a xung quanh muốn mua sách đ a cho ông để ông nhận giảm giá tốt Chúng ta h a cư xử Tiếp theo rơi kệ sách ... trường cho chút thời gian để làm việc Sau thức uống giải khát quay trở lại trường để đáp ứng phần lại bạn lớp Cikgu Hamid chờ đợi Một bạn lớp xuất Sau tất lắp ráp Cikgu Hamid mua sách, khỏi hội trường ... trình duyệt phần sách đẹp minh h a động vật thực vật Ch a thấy lượng lớn thông tin liên quan đến hành tinh quý báu Trước biết nó, n a trôi qua My lòng tốt, nghĩ để qua phần lại triển lãm Vì vậy,...
- 3
- 182
- 0
Tài liệu Managed Investment Funds Product Disclosure Statement - A range of funds that allows you to create an investment portfolio that suits your individual needs ppt
Ngày tải lên :
19/02/2014, 09:20
... also fluctuates daily Transaction costs also apply Refer to the management and transaction costs table above Example of annual fees and costs for a balanced investment fund This table gives an ... advice Who are we? Colonial First State is one of Australia’s leading wealth management providers and a part of the Commonwealth Bank of Australia Group (‘the Bank’) Any financial services offered ... Appoint a financial adviser to transact online on my behalf? By appointing a financial adviser to transact on your behalf, you are giving that adviser, and any person acting on behalf of that adviser,...
- 52
- 577
- 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
Ngày tải lên :
08/10/2012, 15:22
... is unclear what agents are and what they can (and maybe cannot) In the first part, this thesis will provide an overview of these, and many other agent-related theoretical and practical aspects ... generally agreed upon, open standards JAVA itself is not an agent-application Yet, the Java Agent Template is available which "provides basic agent functionality packaged as a Java application ... listed above A clear example of an agent that meets the weak notion of an agent is the so-called softbot (‘software robot’) This is an agent that is active in a software environment (for instance...
- 100
- 811
- 3
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
Ngày tải lên :
25/10/2012, 10:02
... on performance Acta Anaesthesiol Scand 2010, 54(6):689-695 Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure ... of data that could allow for a structured evaluation of the organizational changes It is evident that a well-planned evaluation of changes in the organizations, before they are actually made, ... organization changes The EMD has an essential and important role in the early management of patients, and there are some difficulties in evaluating quality and effectiveness of the EMCC, as described...
- 5
- 495
- 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
Ngày tải lên :
26/10/2012, 09:07
... use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... Whole-animal cellular and molecular imaging to accelerate drug development Drug Discov Today 2002; 7: 555-62 28 Li X, Wang J, An Z, et al Optically imageable metastatic model of human breast cancer Clin ... morphological structures in an outstanding manner MI is defined as the characterization and measurement of biological processes at the cellular and molecular level.[23] At present the rapidly emerging...
- 11
- 655
- 0
Đề thi HSG Hóa 9 Nghệ An 08-09 ( Bảng A)
Ngày tải lên :
18/08/2013, 07:10
... n AgBr = = 0, 06 mol 2 = 0,36 - 0,12 = 0,24 mol Ta cú cỏc phng trỡnh xy ra: Al + 3AgNO3 Al(NO3)3 + 3Ag (3) 2Al(NO3)3 + 3Cu 2Al + 3Cu(NO3)2 (4) Al(OH)3 + 3NaNO3 (5) Al(NO3)3 + 3NaOH Cú th: Al(OH)3 ... 0,5 thỡ ta chn CaCl2 khan Vỡ ch cú CaCl khan sau hp th hi nc u khụng tỏc dng vi cỏc khớ ú Cỏc phng trỡnh hoỏ hc ca cỏc phn ng xy cỏc thớ nghim: 2,0 (Mi pt NaHCO3 + Ba(OH)2 BaCO3 + NaOH +H2O ... Cú th: Al(OH)3 + NaOH NaAlO2 + 2H2O (6) * Theo (3) v (4): Khi Al y Ag lm lng Al tng: 108.0,24 27.0,08 = 23,76 (g) Khi Al y Cu lm lng Al tng: 64.0,06 27.0,04 = 2,76 (g) Vy: m Al tăng = 23,76...
- 5
- 689
- 6
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
Ngày tải lên :
05/09/2013, 16:11
... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ... Vishwavidyalaya (R.G.P.V.) Jatropha plant bears fruits from second year of its plantation and the economic yield stabilizes from fourth and fifth year onwards The plant has an average life with effective...
- 12
- 568
- 0
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch
Ngày tải lên :
16/10/2013, 21:15
... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such ... hostname, access, and command mode passwords, as well as the management LAN settings These values are shown in the chart If problems occur while performing this configuration, refer to the Basic ... exit, and turn all the devices off Then remove and store the cables and adapter 3-4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6.2.9 Copyright 2003, Cisco Systems, Inc Erasing...
- 4
- 337
- 0