... degeneration was also present limits flying performance for 20% of the fighter pilots he studied Investigators are curious about aviators' use of alternative treatments to medicine to manage LBP, ... spine when asked to perform simple non-weight bearing movements called dead bug exercises [15] He had no pain while performing a static crunch Page of (page number not for citation purposes) ... describe the content or effectiveness of such programs for jet aviators Drew [4] reported that 54 of 79 high performance pilots used some form of stretching or exercise to prevent spinal symptoms...
Ngày tải lên: 13/08/2014, 14:20
... integrity performance are identified as components of service availability performance Accessibility performance Retainability performance Integrity performance Component of Support performance Operability ... optimisation process is described (for details see also [18]) Figure 9.14 demonstrates the optimisation process utilising the SOMgenerated performance spectrum This feature makes it much easier for the ... performance spectrum demonstrating cells’ admission control performance ought to be linked to parameters controlling the admission process The performance spectrum also offers powerful means for...
Ngày tải lên: 14/08/2014, 12:21
THIẾT kế THỜI TRANG - CÔNG ĐOẠN KHÔ - DRY PROCESS FOR DENIM
... Nhiệt Độ Sấy % spandex % cotton Nhiệt độ sấy tối đa 99 85 98 80 97 75 Các công đoạn Processes Chà (handsanding) Mài (Grinding) cắt rách, cào xù, nhíu (cutting, scratching, tacking)...
Ngày tải lên: 14/08/2013, 09:21
Application of Ozone/UV Process for the Reclamation of Sewage Treatment Plant Effluent
... UV combination (ozone/UV) process is applied for the reuse of sewage effluent Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process for the treatment of sewage ... ozone/UV processes were significantly effective, showing 80% reduction of A410 after 10 of run time On the other hand, the UV alone process did not show much color change Therefore, for color ... calculated by dividing A254 with DOC, are compared for the ozone alone, UV alone, and ozone/UV combination processes The ozone alone process was performed at the condition of aqueous pH and to investigate...
Ngày tải lên: 05/09/2013, 08:40
IMPROVEMENT OF BIOLOGICAL SOLUBILIZATION AND MINERALIZATION PROCESS FOR FOOD WASTE
... Yaacov, 2001) Biological solubilization and mineralization process was proposed for food wastes (Okada and Nishijima, 2001) In the process, food wastes are mixed with rice hull as biological ... oxygen for the solubilization of food waste The circulating water did not contain oxygen when aeration was not carried out in the circulation tank Therefore, oxygen would be deficient for the ... mineralization process without accumulation of food wastes and to increase mineralization rate for the reduction of organic loading to the sewerage system Biological solubilization and mineralization process...
Ngày tải lên: 05/09/2013, 08:40
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast ... excess sludge Figure Bench-scale continuous activated sludge process Table Influent Composition to the Bench-Scale Simulated Activated Sludge Process RUN RUN1 RUN2 RUN3 RUN4 RUN5 RUN6 RUN DATE 2002 ... was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection...
Ngày tải lên: 05/09/2013, 09:38
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
... Therefore, the land area requirement could be significantly reduced and accordingly construction investment would be cut down This paper reports the experimental results of the CARS process for ... municipal wastewater treatment The technical feasibility of this process was demonstrated, and the process optimization was performed In addition, the adsorption characteristics of the activated ... increased with the decreasing temperature either for dried sludge (Zhou, 1992; Zhou and Banks, 1993) or for activated carbon (McCreary and Snoeyink, 1980) Therefore, it is hypothesized that there existed...
Ngày tải lên: 05/09/2013, 09:38
Phát triển ngôn ngữ ở trẻ 9 18 tháng tuổi thông qua tương tác mẫu tính
... theo thuyết cho ngôn ngữ lĩnh hội thông qua trình liên tưởng, củng cố bắt chước (associations, reinforcement and imitation)[188] Nói cách khác, cha mẹ hay người chăm sóc nhiệt tình thúc đẩy để trẻ...
Ngày tải lên: 25/10/2013, 15:50
Alternative Processing Technologies for the Control of Spoilage Bacteria in Fruit Juices and Beverages
... wash fruits properly before processing is among the main reasons for contamination in fruit juice Washing and brushing fruit before the juicing step is common in juice processing According to ... an alternative processing technology? These are but a few of the signiÞcant issues being addressed The IFT/FDA scientiÞc review of the alternative processing technologies that might be used for ... speciÞc foods, processing conditions, storage conditions, and potential storage abuse affect the determination of the most resistant organism(s) of concern for each alternative processing technology?...
Ngày tải lên: 25/10/2013, 21:20
Alternative earthing calculations for grids and rods
... made with the relevant Schwarz formulae The S34 standard [4] has a formula for a group of rods in the form of a hollow square (EA 41-24-1992 [2] refers to S34 for the formulae it uses) It is R1 R, ... anywhere for the former However, with rods only at the periphery the two compare well, hence only the Schwarz formula is used in the comparisons that follow Schwarz [5] gives a formula for the ... resistance, whereas the former has increasingly less restriction to current flow from the top downwards Tagg [6] gives formulae for r, the radius of an equivalent hemisphere, for three types of rod...
Ngày tải lên: 03/01/2014, 19:15
Tài liệu Module 9: Creating a Security Design for Data pptx
... List guidelines for designing security for data 8 Module 9: Creating a Security Design for Data Steps for Designing an Access Control Model *****************************ILLEGAL FOR NON-TRAINER ... asymmetric encryption Steps for Designing EFS Policies Refer students to the white paper referenced on the page for more information about Encrypting File System (EFS) Guidelines for Managing Data Securely ... suggestions for facilitating the lab environment used in this course vi Module 9: Creating a Security Design for Data Customization Information This section identifies the lab setup requirements for...
Ngày tải lên: 18/01/2014, 05:20
Tài liệu Báo cáo khoa học: "An alternative LR algorithm for TAGs" docx
... satisfying: • CS(N) + C_ CS(N), for each N; • (N, L) • CS(N), for each N such that N
Ngày tải lên: 20/02/2014, 18:20
Tài liệu THE BOOK SELECTION PROCESS FOR THE BOOK CITATION INDEX IN WEB OF SCIENCE pdf
... various publishing formats THE BOOK SELECTION PROCESS BASIC PUBLISHING STANDARDS Currency of publication is a basic criterion in the evaluation process In general, books selected for both Science ... following list of book formats These are the book formats most frequently presented for coverage in the Book Citation Index • Dissertations –– Dissertations are considered for coverage if they ... bibliographic information for all cited references is essential English language full text is highly desirable, but books with full text in a language other than English are also considered for coverage...
Ngày tải lên: 21/02/2014, 21:20
Báo cáo khoa học: "A STOCHASTIC PROCESS FOR WORD FREQUENCY DISTRIBUTIONS" pot
... matrix 7) defines a uniform distribution (all pi# equal), we immediately have that the expected neighborhood density for length rnl is identical for all targets Yt, while for length m~ > rnl the ... probabilities are uniformly distributed 274 Markovian process is fittedas a front end to Simon's stochastic process, a hybrid model results that has the desired properties, since the latter process can ... Simulated Dutch m o n o m o r p h e m i c stems, as generated by a Markov process For the total distribution, N = 224567, V = 58300 For strings of length 4, N = 74618, V 6425 /, 104 35 103 #n / 28...
Ngày tải lên: 08/03/2014, 07:20
The bioliq® bioslurry gasification process for the production of biosynfuels, organic chemicals, and energy pdf
... pyrolysis gas exactly to the demand for a self-sustained process Heat required for FP Much effort has been devoted determining the specific heat required for FP The reaction enthalpy (ΔrH) of ... assumed for successive plants, down to a minimum of maybe only half of the TCI for the very first commercial plant This will be a fast process for the large number of FP plants required; for the ... Examples are: ○ For iron ore reduction, generation of either charcoal or CO or (CO + H2) mixtures via pyrolysis is a renewed old technology ○ Heat generation for high-temperature processes for cement,...
Ngày tải lên: 14/03/2014, 19:20
An Operational Process for Workforce Planning pdf
... ACQUISITION WORKFORCE PROJECTION MODEL B SAMPLE AGENDA FOR CONDUCTING THE WORKFORCE PLANNING PROCESS 49 References 59 55 FIGURES S.1 A Blueprint for Workforce Planning ... General Approach for Focusing the Data-Gathering Activity 4.1 Articulating a Business Case for Change 4.2 A Four-Step Process for Workforce Planning 4.3 An Iterative Process ... application of the structured workforce planning process described herein for its acquisition community during the summer of 2001 ix x An Operational Process for Workforce Planning business units,...
Ngày tải lên: 16/03/2014, 06:20